ID: 934646047

View in Genome Browser
Species Human (GRCh38)
Location 2:96059972-96059994
Sequence GCCTCCAAGACACTACCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934646037_934646047 23 Left 934646037 2:96059926-96059948 CCCTGCTTGGGCCGGGGCTCACC No data
Right 934646047 2:96059972-96059994 GCCTCCAAGACACTACCCCATGG No data
934646043_934646047 -3 Left 934646043 2:96059952-96059974 CCTTACAGACAGCAGGCCCCGCC No data
Right 934646047 2:96059972-96059994 GCCTCCAAGACACTACCCCATGG No data
934646036_934646047 28 Left 934646036 2:96059921-96059943 CCTAGCCCTGCTTGGGCCGGGGC No data
Right 934646047 2:96059972-96059994 GCCTCCAAGACACTACCCCATGG No data
934646039_934646047 12 Left 934646039 2:96059937-96059959 CCGGGGCTCACCAGCCCTTACAG No data
Right 934646047 2:96059972-96059994 GCCTCCAAGACACTACCCCATGG No data
934646038_934646047 22 Left 934646038 2:96059927-96059949 CCTGCTTGGGCCGGGGCTCACCA No data
Right 934646047 2:96059972-96059994 GCCTCCAAGACACTACCCCATGG No data
934646041_934646047 2 Left 934646041 2:96059947-96059969 CCAGCCCTTACAGACAGCAGGCC No data
Right 934646047 2:96059972-96059994 GCCTCCAAGACACTACCCCATGG No data
934646042_934646047 -2 Left 934646042 2:96059951-96059973 CCCTTACAGACAGCAGGCCCCGC No data
Right 934646047 2:96059972-96059994 GCCTCCAAGACACTACCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934646047 Original CRISPR GCCTCCAAGACACTACCCCA TGG Intergenic
No off target data available for this crispr