ID: 934646086

View in Genome Browser
Species Human (GRCh38)
Location 2:96060112-96060134
Sequence CTCCAGTAGCAGCCAGGTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934646070_934646086 27 Left 934646070 2:96060062-96060084 CCCAGGATGGGAAGATTTACTTA No data
Right 934646086 2:96060112-96060134 CTCCAGTAGCAGCCAGGTTCCGG No data
934646080_934646086 -8 Left 934646080 2:96060097-96060119 CCTGGATACCCTGCCCTCCAGTA No data
Right 934646086 2:96060112-96060134 CTCCAGTAGCAGCCAGGTTCCGG No data
934646079_934646086 -7 Left 934646079 2:96060096-96060118 CCCTGGATACCCTGCCCTCCAGT No data
Right 934646086 2:96060112-96060134 CTCCAGTAGCAGCCAGGTTCCGG No data
934646071_934646086 26 Left 934646071 2:96060063-96060085 CCAGGATGGGAAGATTTACTTAG No data
Right 934646086 2:96060112-96060134 CTCCAGTAGCAGCCAGGTTCCGG No data
934646078_934646086 -4 Left 934646078 2:96060093-96060115 CCACCCTGGATACCCTGCCCTCC No data
Right 934646086 2:96060112-96060134 CTCCAGTAGCAGCCAGGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934646086 Original CRISPR CTCCAGTAGCAGCCAGGTTC CGG Intergenic
No off target data available for this crispr