ID: 934648711

View in Genome Browser
Species Human (GRCh38)
Location 2:96074384-96074406
Sequence CGCTGCCTCCTCGGCAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934648708_934648711 4 Left 934648708 2:96074357-96074379 CCAGCAGGAGTCAGTCACAGAGG No data
Right 934648711 2:96074384-96074406 CGCTGCCTCCTCGGCAATGCAGG No data
934648707_934648711 12 Left 934648707 2:96074349-96074371 CCAAGGCTCCAGCAGGAGTCAGT No data
Right 934648711 2:96074384-96074406 CGCTGCCTCCTCGGCAATGCAGG No data
934648705_934648711 20 Left 934648705 2:96074341-96074363 CCACAAAGCCAAGGCTCCAGCAG No data
Right 934648711 2:96074384-96074406 CGCTGCCTCCTCGGCAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934648711 Original CRISPR CGCTGCCTCCTCGGCAATGC AGG Intergenic
No off target data available for this crispr