ID: 934649845

View in Genome Browser
Species Human (GRCh38)
Location 2:96084627-96084649
Sequence CTCTCCACGACCGCCTGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934649845_934649853 1 Left 934649845 2:96084627-96084649 CCCCTCCAGGCGGTCGTGGAGAG No data
Right 934649853 2:96084651-96084673 GGGCACCTCCTCCAGGCCCAGGG No data
934649845_934649852 0 Left 934649845 2:96084627-96084649 CCCCTCCAGGCGGTCGTGGAGAG No data
Right 934649852 2:96084650-96084672 TGGGCACCTCCTCCAGGCCCAGG No data
934649845_934649862 23 Left 934649845 2:96084627-96084649 CCCCTCCAGGCGGTCGTGGAGAG No data
Right 934649862 2:96084673-96084695 GCCTCCCTCCCTGGCAGCCGGGG No data
934649845_934649861 22 Left 934649845 2:96084627-96084649 CCCCTCCAGGCGGTCGTGGAGAG No data
Right 934649861 2:96084672-96084694 GGCCTCCCTCCCTGGCAGCCGGG No data
934649845_934649851 -6 Left 934649845 2:96084627-96084649 CCCCTCCAGGCGGTCGTGGAGAG No data
Right 934649851 2:96084644-96084666 GGAGAGTGGGCACCTCCTCCAGG No data
934649845_934649860 21 Left 934649845 2:96084627-96084649 CCCCTCCAGGCGGTCGTGGAGAG No data
Right 934649860 2:96084671-96084693 GGGCCTCCCTCCCTGGCAGCCGG No data
934649845_934649857 14 Left 934649845 2:96084627-96084649 CCCCTCCAGGCGGTCGTGGAGAG No data
Right 934649857 2:96084664-96084686 AGGCCCAGGGCCTCCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934649845 Original CRISPR CTCTCCACGACCGCCTGGAG GGG (reversed) Intergenic