ID: 934655023

View in Genome Browser
Species Human (GRCh38)
Location 2:96112841-96112863
Sequence CTTGTTGCCCAAAGGCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934655023 Original CRISPR CTTGTTGCCCAAAGGCTGCC TGG (reversed) Intergenic
900269165 1:1778400-1778422 CCTGTTGCCCCATGGCCGCCCGG + Intronic
901395193 1:8976006-8976028 CTTGTTGGTCAAATGGTGCCTGG + Intergenic
904266831 1:29323187-29323209 CCAGTTGCCCACAGGCTGCAAGG - Intronic
906572516 1:46855972-46855994 CTTTTTGCCCTAAGGCTCCATGG - Intergenic
906599254 1:47109924-47109946 CTTTTTGCCCTAAGGCTCCATGG + Intronic
907606934 1:55827480-55827502 TATGTTGCACAAAGCCTGCCTGG + Intergenic
908473711 1:64469795-64469817 CTTCTTCCCCAACCGCTGCCAGG + Intergenic
912745995 1:112245984-112246006 CCTATTACCCACAGGCTGCCTGG + Intergenic
921051234 1:211513286-211513308 CTTGTTTCCCAAACCCTGCATGG - Intergenic
923867415 1:237954884-237954906 CCTGTTGTCAAAAGGCAGCCTGG - Intergenic
923882845 1:238122640-238122662 ATTCTAGCCCAAAGGCTGGCAGG + Intergenic
1063074411 10:2700444-2700466 CATGTGGCCCAAAGACTGCATGG + Intergenic
1064229905 10:13520821-13520843 CTTGTTGCCTAAAGTCTGGGAGG - Intronic
1064785164 10:18887090-18887112 CTTCTGGGCCAAAGGTTGCCTGG - Intergenic
1065766236 10:29032423-29032445 CTAGATGCCCCAATGCTGCCTGG - Intergenic
1066359595 10:34717341-34717363 CTTGTGGGAAAAAGGCTGCCTGG - Intronic
1069566719 10:69468272-69468294 CTGGCTGCCCACAGCCTGCCTGG + Intronic
1071759087 10:88580067-88580089 CTTCTAGTCCAAAGGCTGGCAGG - Intronic
1073162360 10:101409581-101409603 CTTGTTGCTCCCAGGCTACCTGG + Intronic
1074248004 10:111713965-111713987 CTTGGTGCCCAAAGTCTGGAGGG + Intergenic
1075659193 10:124181627-124181649 CTTGTTCCCCAAGGGCTGCTAGG - Intergenic
1076628302 10:131835029-131835051 CTTGATGCCCTCTGGCTGCCAGG - Intergenic
1076834669 10:133014989-133015011 CTTCCTGCCCAGAGGCAGCCCGG - Intergenic
1077251638 11:1563385-1563407 CCTGTGGCCCAAAAGCAGCCTGG - Intronic
1077831795 11:5880608-5880630 CTTGTTGCTCAGAGGCTTCAAGG + Intronic
1078028609 11:7724688-7724710 CTTGTTCGCCAGAAGCTGCCAGG + Intergenic
1078357521 11:10643334-10643356 CTGGCTCCCCAAAGGCTCCCCGG + Intronic
1078641194 11:13098340-13098362 CTGATTGCACAACGGCTGCCAGG + Intergenic
1079157561 11:17962771-17962793 CTTGTTCCCTCAAGCCTGCCAGG - Intronic
1083935735 11:65869076-65869098 CTTGTTCCCCTCATGCTGCCAGG + Intronic
1086125073 11:83342011-83342033 CTTGTTGCTCAAAGCCTGTTTGG - Intergenic
1088815591 11:113418741-113418763 CCTGTAGCCCAAAGCCTGCCAGG + Intronic
1089676735 11:120095482-120095504 CTGGTTCCCCACAGCCTGCCTGG + Intergenic
1091589720 12:1836054-1836076 CGTGCTGCCCAGAGGCTCCCAGG + Exonic
1093705610 12:22271982-22272004 CTTTTTCCCCAAAGGTTTCCTGG + Intronic
1094772121 12:33675247-33675269 CTTTTTGCCAAAAGGTTTCCTGG - Intergenic
1095296180 12:40530189-40530211 CTTGTTGCCCACATTCTTCCAGG + Intronic
1095928545 12:47603704-47603726 CTGGTGGCACAAAAGCTGCCAGG - Intergenic
1096018145 12:48296986-48297008 CTTCTTGCCCCAAGGCTGAGGGG - Intergenic
1100353473 12:93807131-93807153 GTTGATGCCCAAAGGCTCTCAGG + Intronic
1101064941 12:101011111-101011133 AATGCTGCCCCAAGGCTGCCAGG - Intronic
1101566712 12:105912706-105912728 TTTGTTGTCCAAAGGCTTTCTGG + Intergenic
1102678046 12:114671936-114671958 CTTGTCGCCCAAACTCTGCGCGG - Exonic
1110362519 13:74643393-74643415 CTTGTCACCAAATGGCTGCCTGG - Intergenic
1110834282 13:80065954-80065976 CTTGTTTACCAGGGGCTGCCAGG + Intergenic
1112463291 13:99621660-99621682 CATGTGGCCCACAGGCTGCAGGG - Intronic
1114427013 14:22632227-22632249 CTTGGTGCCCAAACACTGTCTGG - Intergenic
1117967651 14:61221896-61221918 CTTTTTGCTAAAAGGCAGCCTGG + Intronic
1119549039 14:75494727-75494749 CATGATGCCCAAAGGGTCCCTGG + Intergenic
1122370184 14:101225316-101225338 CTTGCTGGGCACAGGCTGCCTGG + Intergenic
1122957078 14:105075875-105075897 CTGGCTGCCCGAAGGCTACCAGG - Intergenic
1124122979 15:26908000-26908022 CCTGATGCCCAAATCCTGCCTGG - Intronic
1125087284 15:35745185-35745207 CCTTTTGACCATAGGCTGCCTGG - Intergenic
1128103904 15:65029215-65029237 CTAGGCGCCCAAAGGCTGACCGG + Intronic
1130663857 15:85853084-85853106 CTTCTTGAACAATGGCTGCCAGG - Intergenic
1131134148 15:89920536-89920558 CTTGTTGCCTCTGGGCTGCCTGG - Intergenic
1132150140 15:99453265-99453287 CTTGCACCCCAAAGCCTGCCTGG + Intergenic
1132946551 16:2534746-2534768 CTTGTGGGCCAGAGGCAGCCAGG + Intergenic
1133202044 16:4209589-4209611 CTTGTTCCCCAAAAGCTGGGTGG + Intronic
1135507094 16:23048452-23048474 TTTGTTGTACAAAGCCTGCCAGG - Intergenic
1137039571 16:35598098-35598120 CTTAAGGCCCAAAGGCAGCCAGG - Intergenic
1138116388 16:54364056-54364078 CTTGTAACCCCAAGGCTGCCTGG - Intergenic
1138595614 16:58027532-58027554 CTTGGTGCCCTTGGGCTGCCCGG + Intronic
1139694950 16:68667347-68667369 ATTGTGGCCAAAAGGCAGCCTGG - Intronic
1140935014 16:79662325-79662347 CATGTTGTCCACAGGCTCCCTGG + Intergenic
1142356007 16:89602422-89602444 CTTGCTGGCCACCGGCTGCCTGG + Intergenic
1146293497 17:31630279-31630301 CTTCTTGCCCAAAGCCTGTTGGG - Intergenic
1146801035 17:35822667-35822689 CTTGTTGACCATAGTCTGGCTGG - Exonic
1147894157 17:43739603-43739625 CATCATTCCCAAAGGCTGCCTGG - Intergenic
1149582592 17:57761773-57761795 CTTGTTGCCCAAAGGCCACATGG + Intergenic
1152625283 17:81385322-81385344 CGTGTGGCCCTAAGGCTCCCAGG + Intergenic
1155606710 18:27614325-27614347 CTTGTTCAACAAAGGATGCCTGG + Intergenic
1159036980 18:63286770-63286792 CTTGGTGCCCAATCTCTGCCAGG + Intronic
1159623810 18:70669392-70669414 CTTGGTGCCCAAAGTCTGGAGGG - Intergenic
1161569116 19:5020584-5020606 CTTGGTGCCCAGAGGAAGCCAGG + Intronic
1163443436 19:17333312-17333334 CGTTTGTCCCAAAGGCTGCCAGG - Intronic
1165255463 19:34575251-34575273 CTGGTGGCCCAAGGCCTGCCTGG - Intergenic
1165819847 19:38667594-38667616 TTTGTGGCCCAAAGGCAGCGTGG + Intronic
1166480693 19:43170588-43170610 CTTCTTTCCCACAGGCTCCCAGG + Intronic
1166705875 19:44907746-44907768 CTTGTTCCACACAGGATGCCAGG + Exonic
925310618 2:2879015-2879037 CTTTTAGCCAAAAAGCTGCCTGG - Intergenic
925645846 2:6036267-6036289 ATTGATGCCCAATGGTTGCCAGG - Intergenic
926348125 2:11968179-11968201 CTTGCTGCCTAAAAGCTGCTTGG + Intergenic
928436560 2:31258278-31258300 CTTGCTGCCCTAAAGCTTCCTGG - Intronic
929996224 2:46827894-46827916 CTCGTAGCCCCCAGGCTGCCTGG - Intronic
932467339 2:71932382-71932404 CTTGGTTCCCCAAGCCTGCCAGG + Intergenic
932564518 2:72897086-72897108 CTTTCTGCCCAAAGGCTGGATGG + Intergenic
934655023 2:96112841-96112863 CTTGTTGCCCAAAGGCTGCCTGG - Intergenic
935349011 2:102137572-102137594 CTTGATGCCCAGAGCTTGCCAGG - Intronic
937956916 2:127426774-127426796 TTTGTGGCCCCCAGGCTGCCTGG - Intronic
938344440 2:130557149-130557171 CTGGGTGCCCACAGCCTGCCTGG - Intergenic
938345393 2:130563573-130563595 CTGGGTGCCCACAGCCTGCCTGG + Intergenic
943157317 2:184199181-184199203 CTTGTTGCTCAAAGTCTGTTTGG + Intergenic
943312809 2:186347986-186348008 ATTGGAGCCCAAAGTCTGCCTGG + Intergenic
948941378 2:241198517-241198539 CACGTTGCCCAAAGTGTGCCTGG + Intronic
1172098637 20:32472962-32472984 CCTGCTGCCCAGAGGCTGGCTGG - Intronic
1172597879 20:36162752-36162774 CTTCTTGCCCAAAAGCTTCACGG - Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175976265 20:62711821-62711843 CTTGTTGCTCAGAGGCTGCGAGG + Intronic
1181777001 22:25166904-25166926 CTTGTTGTCCCGAGGCTGCAAGG - Intronic
1182472123 22:30555112-30555134 CTTGGTGCCCAGCGGCTGCCAGG + Exonic
949945413 3:9185913-9185935 ATTGTTCCCCAAATGCTCCCAGG + Intronic
953535651 3:43774874-43774896 ATTGTTGCCCTCAGGCTGCCAGG - Intergenic
957216714 3:77329522-77329544 CTTATTGACAAAAAGCTGCCAGG - Intronic
960246810 3:115408676-115408698 GGTGTTGCCCACAGGTTGCCTGG + Intergenic
961205769 3:125080342-125080364 ATTGTTGCCCAAGAGCTTCCTGG - Intergenic
962919392 3:139936513-139936535 CTTGGTCCCCAAATCCTGCCTGG + Intronic
963814516 3:149814133-149814155 CTTGTTGCCCCAAACCTGCCCGG + Intronic
967953223 3:194856893-194856915 CCTGGTACCCAAAGGCTTCCTGG + Intergenic
969575498 4:8033978-8034000 CCCGATGCCCCAAGGCTGCCAGG + Intronic
969844598 4:9910529-9910551 CTTAATGCCCTCAGGCTGCCAGG + Intronic
972633030 4:40857858-40857880 CTTTCTGCCCAAAGGCTTTCTGG - Intronic
973019727 4:45187628-45187650 ATTGTTGCTTAAAAGCTGCCAGG + Intergenic
973309556 4:48693992-48694014 ATTTTTGCCCAAAGGCTGCAAGG + Intronic
973784166 4:54319510-54319532 CTTTCTGCCCAAAGGCTACCTGG - Intergenic
981619227 4:146674916-146674938 CTTGTCTCCCAAAGTCTTCCTGG - Intergenic
984834935 4:184010778-184010800 CTTGTGCCCCACAGGCTCCCTGG - Exonic
985331007 4:188833980-188834002 GTTGCTCCCCAAAGGCTGCGTGG + Intergenic
985824653 5:2183346-2183368 CTTGCTCCTCAAATGCTGCCTGG + Intergenic
986551592 5:8962108-8962130 CTTGTTCCCCACAGTCTGACAGG + Intergenic
988555442 5:32232295-32232317 CTTCTTACCCAAAGGCTTCAAGG + Intronic
988675390 5:33428025-33428047 CTTGTTGTCCAGATGCTTCCTGG + Intergenic
989611350 5:43295744-43295766 CCTCTTACCCAAAGGCTTCCAGG + Exonic
990135349 5:52638108-52638130 CTTGTTTCAGAATGGCTGCCAGG - Intergenic
1002563977 5:180099893-180099915 CATGTTGCCCAAGGGGTGCCAGG + Intergenic
1002636294 5:180610341-180610363 CTTGCAGCCCCAGGGCTGCCTGG - Intronic
1014273644 6:119362769-119362791 ATTGTTGTCCTGAGGCTGCCTGG - Intergenic
1018460895 6:163997339-163997361 TCTGTTGCCCAACGGCTGTCAGG + Intergenic
1018808672 6:167281437-167281459 CTTGTAGCTAAAAGGCAGCCAGG + Intronic
1020975896 7:15006091-15006113 CTCATTGGCCAAAGGCTGCCAGG - Intergenic
1022471118 7:30682410-30682432 GGTGGCGCCCAAAGGCTGCCCGG - Intronic
1023794716 7:43782291-43782313 GTTGTGGCCCAGAGGCTGGCTGG + Intronic
1028693876 7:93685517-93685539 CTTATTTCACACAGGCTGCCTGG - Intronic
1029545324 7:101207472-101207494 CATGGAGCCCAAATGCTGCCGGG + Intronic
1029694803 7:102205564-102205586 TTTCTTGCTCAGAGGCTGCCTGG - Intronic
1035479078 7:159167579-159167601 CTTGTTGCCCAGGAGCAGCCAGG - Intergenic
1038394770 8:27238615-27238637 CTTGATGACAAAAGGCTGGCAGG + Intronic
1040488290 8:47895367-47895389 TTTGTTGGACAAAGGCTGCTAGG - Intronic
1042173029 8:66010631-66010653 CTTCTTGCCCACAGGTTGGCTGG - Intergenic
1045330979 8:101155366-101155388 CTTGGTGCCCAAAGAATGGCTGG + Intergenic
1047846783 8:128814756-128814778 CTTTTTCCCCAAAGGTTACCAGG - Intergenic
1049595124 8:143479937-143479959 CTTGCAGGCCAGAGGCTGCCCGG + Intronic
1052978382 9:34429054-34429076 CTTCTAGCCCAAACTCTGCCAGG + Intronic
1054161361 9:61673986-61674008 CCTGATACCCAAAGACTGCCAGG + Intergenic
1061008709 9:127942903-127942925 CTTCTTGCCCACAAGCTGCACGG + Exonic
1185617478 X:1432175-1432197 CTTCTTTCCCAAAGGCTGGGTGG + Intronic
1190264232 X:48817878-48817900 CCTGGTTCCCAAGGGCTGCCCGG - Intronic
1195230128 X:102838654-102838676 CTTTGTGCCCTGAGGCTGCCAGG - Intergenic
1197776761 X:130123252-130123274 CTAGTTGCCCAAAGCCATCCAGG + Intergenic
1199637968 X:149831567-149831589 CTTAAGGCCCAAAGGCAGCCAGG + Intergenic
1200135678 X:153873495-153873517 CATGTAGCCCAGAGGCAGCCAGG + Intronic
1200162800 X:154018026-154018048 CTTCCTGCCCAACGGCTCCCTGG - Exonic
1201905287 Y:19080685-19080707 GTGGTTGCCAAAAGGTTGCCAGG - Intergenic