ID: 934655141

View in Genome Browser
Species Human (GRCh38)
Location 2:96113392-96113414
Sequence GAGCAGCGTGGCTGGGTCCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 253}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934655135_934655141 -5 Left 934655135 2:96113374-96113396 CCCCATCAGCATTGCGGGGAGCA 0: 1
1: 0
2: 0
3: 7
4: 96
Right 934655141 2:96113392-96113414 GAGCAGCGTGGCTGGGTCCGAGG 0: 1
1: 0
2: 0
3: 13
4: 253
934655131_934655141 8 Left 934655131 2:96113361-96113383 CCTCAATGCACAGCCCCATCAGC 0: 1
1: 0
2: 0
3: 27
4: 309
Right 934655141 2:96113392-96113414 GAGCAGCGTGGCTGGGTCCGAGG 0: 1
1: 0
2: 0
3: 13
4: 253
934655136_934655141 -6 Left 934655136 2:96113375-96113397 CCCATCAGCATTGCGGGGAGCAG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 934655141 2:96113392-96113414 GAGCAGCGTGGCTGGGTCCGAGG 0: 1
1: 0
2: 0
3: 13
4: 253
934655130_934655141 23 Left 934655130 2:96113346-96113368 CCAGGAAGCAGGGGTCCTCAATG 0: 1
1: 0
2: 2
3: 18
4: 166
Right 934655141 2:96113392-96113414 GAGCAGCGTGGCTGGGTCCGAGG 0: 1
1: 0
2: 0
3: 13
4: 253
934655137_934655141 -7 Left 934655137 2:96113376-96113398 CCATCAGCATTGCGGGGAGCAGC 0: 1
1: 0
2: 1
3: 15
4: 134
Right 934655141 2:96113392-96113414 GAGCAGCGTGGCTGGGTCCGAGG 0: 1
1: 0
2: 0
3: 13
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934655141 Original CRISPR GAGCAGCGTGGCTGGGTCCG AGG Exonic
900132597 1:1093805-1093827 GAGCAGAGTGGCTGGCTCACAGG + Intronic
900151999 1:1182820-1182842 GAGGGGCGTGGCTGGGTTGGGGG + Intronic
900245323 1:1633695-1633717 GGGCGGCGGGGCTGGGCCCGGGG + Intronic
900256554 1:1700854-1700876 GGGCGGCGGGGCTGGGCCCGGGG + Intronic
900431733 1:2605977-2605999 GAACAGCGGGGCTGGAACCGGGG - Intronic
900885134 1:5409835-5409857 CAGCAGTGGGGCTGGGTCAGGGG - Intergenic
901381627 1:8878459-8878481 GCCCAGCGTGGCGGGGTCGGGGG - Intronic
901632227 1:10653537-10653559 GACCAGCGTGGGTGTGTCAGGGG + Exonic
901905060 1:12401265-12401287 GAGCAGCATGGCTGGGCTTGTGG - Intronic
902619911 1:17644736-17644758 GAGAAGCAGGGCTGGGCCCGCGG + Intronic
904492797 1:30870984-30871006 GAGCAGAAGGGCTGGGTCCTGGG - Intronic
905609130 1:39333714-39333736 GAGCACAGTGTCTGGGTACGGGG - Intronic
905909058 1:41641380-41641402 CAGAAGCCTGGCTGGGTCCCCGG - Intronic
908501219 1:64745225-64745247 GCGCGGCGGGGCTGGGGCCGGGG + Exonic
915560138 1:156682304-156682326 GGGCAGCCTGGCTGGGACCTGGG + Intergenic
915941032 1:160118296-160118318 GAGGAGCAGGGCTGGGTCTGTGG - Intronic
917072644 1:171169190-171169212 CTTCAGTGTGGCTGGGTCCGGGG - Intergenic
917141752 1:171841956-171841978 GGGCAGAGTGGCGGTGTCCGTGG + Intronic
917237781 1:172913098-172913120 CACCAGTGTGGCTGGGTCTGGGG + Intergenic
920387238 1:205577631-205577653 CTCCAGCCTGGCTGGGTCCGTGG + Intronic
922472181 1:225883165-225883187 GGGAAGCGAGGCTGGGTTCGGGG + Intergenic
922764125 1:228148853-228148875 GCCCAGCGAGGCTGGGTCGGGGG - Exonic
924494680 1:244575550-244575572 TAGCTGCATGGCTGGGTGCGAGG + Intronic
1062817200 10:509401-509423 GAGCAGCGCGGATGGATCCAGGG - Intronic
1063605637 10:7520743-7520765 GAGCTGCTTGGCTTGGTCCCGGG - Intergenic
1064560824 10:16594053-16594075 GCGCAGCGAAGCTGGCTCCGTGG + Intronic
1064639867 10:17404696-17404718 GAGCAGCGCAGCGGGGTCAGTGG - Intronic
1065326832 10:24556882-24556904 GAACAGGGTGGCTGGGCCAGAGG - Intergenic
1065733764 10:28732716-28732738 GATCAGCGTGGCTGGGATGGAGG + Intergenic
1070812196 10:79304028-79304050 CAGCAGCGTGGCTGCCTCCTCGG + Exonic
1070890889 10:79941634-79941656 GAGCTGCATGGCTGGGTACTGGG - Intronic
1072388780 10:94960332-94960354 CAGCAGCGAGGCTGGGTGAGGGG - Intronic
1072448305 10:95518616-95518638 AGGCAGTGTGGCTGGGTCCTAGG - Intronic
1072529619 10:96306687-96306709 GAGCAGCTGGGCTTGGTCCCTGG - Intronic
1072615751 10:97048055-97048077 GAGCAGTGGGGCTGGGGCCTGGG - Intronic
1074564397 10:114564170-114564192 GAGCAACGAGGCCGGGTCCAGGG - Intronic
1074616902 10:115078817-115078839 CAGCAGCGAGGCTGGGGCAGGGG - Intergenic
1075798584 10:125137972-125137994 GAGGAGCGTGGCTGGCTATGAGG - Intronic
1076061489 10:127417302-127417324 GGGCAACGTGGCTGGGTCTAAGG - Intronic
1076525087 10:131107484-131107506 GAGCACAGTGGCTGGGACCCGGG + Intronic
1076764182 10:132624133-132624155 GAGCAACGTGCGTGGGTCAGGGG - Intronic
1082821341 11:57546362-57546384 GAGCTGCGTGGGTGGGGCAGGGG + Intronic
1083629314 11:64087619-64087641 CTGCAGGGTGGCTGGGGCCGCGG - Intronic
1083754987 11:64787469-64787491 GACCAGGGTGGCTGGGGACGGGG + Intergenic
1084225326 11:67711663-67711685 GAGGAGGGAGGCTGAGTCCGGGG + Intergenic
1084263140 11:67991510-67991532 GAGGAGGGAGGCTGAGTCCGGGG + Exonic
1084521592 11:69666480-69666502 GAGCAGAGTGGATGGTTCGGTGG - Exonic
1084572091 11:69965993-69966015 AAGCAGCGTGGCAGGGCCTGGGG - Intergenic
1084810254 11:71607611-71607633 GAGGAGGGAGGCTGAGTCCGTGG - Intergenic
1084942010 11:72617963-72617985 GAGCATGGTGGCTGGGACCCCGG - Intronic
1085024598 11:73229236-73229258 GTGCAGTGTGGGTGGGTTCGGGG + Intronic
1085473522 11:76773351-76773373 GTTCAGCGTGGCTGGGTACAGGG - Intergenic
1087088985 11:94248470-94248492 CAGCAGCGTGGCTGGGGGAGGGG + Intergenic
1090913212 11:131140118-131140140 GAGCATCATGGCTGGGACCCAGG + Intergenic
1091221174 11:133930923-133930945 GAGCAGGCTGGCTGGGGGCGGGG - Intronic
1091274581 11:134341944-134341966 GTGCTGGGTGGCTGAGTCCGGGG - Intronic
1092578369 12:9814105-9814127 CAGCCGTGTGGCTGGGTCCCTGG + Intergenic
1094838723 12:34334217-34334239 GGGCAGCGTGGTTGGGGCCAGGG - Intergenic
1096573987 12:52541253-52541275 GGGCTGCATGGCTGGGGCCGGGG - Intergenic
1096636094 12:52960570-52960592 CAGCAGCGAGGATGGGTCCTGGG + Intergenic
1100364493 12:93907260-93907282 GGGCAGCTGGGCTGGGACCGGGG - Intergenic
1101758593 12:107640948-107640970 GAGCAGTGAGGCTGGGGCGGAGG + Intronic
1102563369 12:113778699-113778721 GAACTGCGTGGCTGGGACTGGGG + Intergenic
1103623615 12:122203621-122203643 GAGACCCGCGGCTGGGTCCGGGG + Exonic
1103923342 12:124410774-124410796 GAGCAGCCAGGCTTGGTCCCTGG - Intronic
1112325687 13:98441547-98441569 GAGCAGCGTTCCTTGCTCCGGGG + Intronic
1112899969 13:104346066-104346088 CAGCAGCGAGGCTGGGGGCGGGG - Intergenic
1116356812 14:43939709-43939731 GAGCAGCGGGGCTGGTTGGGGGG - Intergenic
1118774800 14:68967070-68967092 GAGCAGCATGGCAGGGGCTGAGG + Intronic
1122883597 14:104700813-104700835 CAGCAGCGTGGCTGGGGAGGAGG - Intronic
1122895100 14:104752914-104752936 GATCAGGGTGGGCGGGTCCGTGG - Intergenic
1122925930 14:104900179-104900201 GAGTAGAATTGCTGGGTCCGAGG - Intergenic
1122957549 14:105077888-105077910 GAGCTGCCTGGCTGAGGCCGAGG - Intergenic
1125761960 15:42103009-42103031 GAGCAGGCTGGCTGGGGCCCTGG - Intergenic
1126823545 15:52528531-52528553 GAGCAGCGCGGCAGGGGCCTGGG + Intronic
1127549078 15:60019117-60019139 GAGCTGCCTGCCTGGGTCCCAGG - Intronic
1128893904 15:71355680-71355702 GAGCAGTCAGGCTGGGTCTGTGG + Intronic
1129608695 15:77037132-77037154 GGGCAGCGTGGCTTCGTCCCTGG + Exonic
1130891132 15:88135074-88135096 GGGCAGCGTAGCTGGATCGGAGG - Intronic
1130932250 15:88437880-88437902 GAGGAGCTAGGCTGGCTCCGGGG + Intergenic
1131279285 15:91007654-91007676 GAGCAGGGTGGCAGGGCCTGGGG + Intronic
1132665980 16:1081552-1081574 GCTCAGCGGGGCTGGGGCCGGGG - Intergenic
1133172893 16:3992715-3992737 GAGCAGGGTGCATGGGTCGGGGG + Intronic
1133340081 16:5030373-5030395 GAGCAGCGTGGGTGAGTCCTGGG - Exonic
1135141945 16:19929423-19929445 GAGGAACGTGGCTGGGGGCGTGG + Intergenic
1136568785 16:31084800-31084822 GGGGAGCGTGGCTGGGTTCTGGG - Exonic
1137013146 16:35344409-35344431 GAGCAGTGTGGATGGCGCCGTGG - Intergenic
1138527277 16:57616381-57616403 GAGCAGAGAGGCTGAGCCCGCGG + Intronic
1139432421 16:66918257-66918279 AAGCAGGGTGGCTGGGCCTGGGG - Intronic
1142237853 16:88931088-88931110 TAGCAACGTGGATGGGTCCCTGG - Intronic
1142368613 16:89664846-89664868 GTGCAGCGTGGCTGGGACGCAGG - Intronic
1142683075 17:1561873-1561895 GAGCCGGGTGGATGGGTCAGAGG - Intronic
1143637874 17:8176710-8176732 GGGCAGCGTAGCTGGGGCTGGGG - Intergenic
1144683889 17:17213765-17213787 GAGCATCCTGGGTGCGTCCGAGG - Exonic
1145039642 17:19567742-19567764 AAGCAGCATGGCTGGATCCTTGG + Intronic
1145278731 17:21453423-21453445 GAGGAGGGTGGCTGTGTCCCAGG + Intergenic
1145399121 17:22517062-22517084 GAGGAGGGTGGCTGTGTCCCAGG - Intergenic
1146133395 17:30297399-30297421 TCCCAGTGTGGCTGGGTCCGGGG - Intergenic
1147139716 17:38454145-38454167 GAGCCGCGGGGCCGGGGCCGGGG + Intronic
1147864567 17:43544254-43544276 GGGGTCCGTGGCTGGGTCCGTGG - Intronic
1148325225 17:46779443-46779465 GAGGAGGGTGGCAGGGTCCTAGG - Intronic
1148452628 17:47789985-47790007 GCGCAGCGAGCCTGGGGCCGGGG - Intergenic
1149240147 17:54639597-54639619 GAGCAGCCTGGCAGGGGGCGGGG + Intergenic
1151328880 17:73395123-73395145 CAGCAGGGTGGCTGGGTGTGAGG + Intronic
1151979978 17:77502942-77502964 GTGCAGGGTGGCTGGGTACCGGG - Intergenic
1152564029 17:81092232-81092254 GGGCAGCGAGGCTGGGCCCATGG + Intronic
1152628616 17:81399681-81399703 GAGCAGCGCGGCCGGGGCCCGGG - Exonic
1152702938 17:81828477-81828499 GAGCAGAATGGCTGGGTCATAGG - Intronic
1152779913 17:82222308-82222330 GAGCGGAGTTGCTGGGTCCCAGG - Intergenic
1152799031 17:82322608-82322630 GGGCAGCATGGCAGGGTGCGTGG - Intronic
1152814482 17:82399349-82399371 GGGCAGCGAGGCTGGCACCGGGG - Intronic
1152884348 17:82840642-82840664 GAGCAGGGTGTGTGGGTGCGGGG + Intronic
1155030411 18:21979022-21979044 GAGCAGGGCCGCTGTGTCCGTGG + Intergenic
1161031523 19:2059917-2059939 GAGCAGCGTGGATGGCCCCATGG - Intergenic
1161149969 19:2702509-2702531 GAGGAGGGGGGCTGGGTCTGGGG - Intronic
1161155925 19:2731914-2731936 GAGCAGCGTCCCTGTGTCCACGG + Intronic
1161219461 19:3111686-3111708 GAGCAGAATTGCTGGGTCCCAGG + Intronic
1161289032 19:3483080-3483102 GAGGAGGGTGGCCGGGGCCGGGG - Intergenic
1161353945 19:3808932-3808954 GAGCAGTGCGGCTGGGCCCCTGG - Exonic
1161410148 19:4112557-4112579 GAGAAGCATGGCAGGGCCCGGGG + Intronic
1161577298 19:5061427-5061449 GAGCAGGGTGGCTTGTTCCCAGG - Intronic
1161648654 19:5470440-5470462 GAGAGGCGTGGCTGGGTCATAGG - Intergenic
1162753543 19:12843507-12843529 GAGCACCTTGGCTGGGTTCCAGG + Exonic
1162774916 19:12973638-12973660 GAGCATCGTGGATGGGTGCACGG + Exonic
1165452197 19:35890174-35890196 ATGCAGCGTGGCTGTGGCCGGGG - Intronic
1166391835 19:42412738-42412760 GGGCAGCCTGGCTGGGTGAGAGG - Intronic
1167492934 19:49802292-49802314 GAGCAGGGAGGCTGGGGCAGGGG - Intronic
1167509490 19:49888548-49888570 GGGCTGCGGGGCTGTGTCCGTGG - Exonic
1167592872 19:50413877-50413899 AAGGTGCGTGGCTGGGTCAGGGG + Exonic
1167648532 19:50718264-50718286 GGGCGGCGTGGCTGGGTACCTGG - Intronic
925856240 2:8132648-8132670 CAGCTGCATGGCTGGGTCTGAGG - Intergenic
925928339 2:8685882-8685904 GGGCAGCGCGGCTGGCGCCGCGG - Intergenic
926007833 2:9386527-9386549 GAGCAGCGTGGATGAGTCTTAGG - Intronic
927894304 2:26771589-26771611 GAGCAGCCCTGCTGGGTCTGTGG + Intronic
932276264 2:70454420-70454442 GAGCAGTGTGCCTGGGCACGAGG + Intronic
934655141 2:96113392-96113414 GAGCAGCGTGGCTGGGTCCGAGG + Exonic
937423536 2:121778302-121778324 GAGCAGCGTGGCTTGCTGCCTGG - Intergenic
937866139 2:126753039-126753061 CAGCAGGGTGGCAGGGGCCGAGG + Intergenic
939629706 2:144517004-144517026 GGGCAGCGGGGCTGGGGGCGCGG + Intronic
941295773 2:163736600-163736622 GAGCAGCGCGGCTCTGTCCCGGG - Intergenic
942277723 2:174335055-174335077 GCGCAGCGAGGCTGGGAGCGGGG - Exonic
944218553 2:197279555-197279577 GAGCAGCTTGGCTGGAGCAGAGG - Intronic
945186783 2:207147567-207147589 GTGCAGAGTGGCTGGGGCGGAGG + Intronic
946155103 2:217802015-217802037 AAGCAGCCTGGCTGGGGCCCAGG - Exonic
947117975 2:226791770-226791792 GAGCCGCGCGGCTGTGCCCGAGG + Intronic
948661305 2:239508173-239508195 GAGAAGGGAGGCTGGGTCCCAGG - Intergenic
948680348 2:239629700-239629722 GGGCAGCGTGGCTCTGTCCTGGG + Intergenic
948915101 2:241030432-241030454 GCGCAGCATGGCTGGGTCGGTGG - Exonic
1170606722 20:17880220-17880242 CAGCAGGGTGACTGGGTCCCCGG + Intergenic
1172389686 20:34558598-34558620 GCGCAGAGAGCCTGGGTCCGCGG - Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1172844087 20:37919421-37919443 GAGAAGCCTGGCTGTGTCCAGGG - Intronic
1174368982 20:50073600-50073622 AAGCTGGGTGGCTGGGTCAGGGG - Intergenic
1174759813 20:53195975-53195997 GAGCAGCGTGGATGGCTCGTTGG + Intronic
1175221760 20:57421316-57421338 GTGCAACCTGGCTGGGTCAGCGG - Intergenic
1175781705 20:61686943-61686965 GAGCAGAGTTGCTGGGTCGGGGG - Intronic
1175883519 20:62274324-62274346 GAGCAGCCTGGCTGGGGCTCCGG + Intronic
1178583859 21:33857196-33857218 GGGCGGCGTGGCTGGCTCCATGG - Intronic
1181457507 22:23068114-23068136 GACCAGTGTGGCTGGGGCCAGGG - Intronic
1181545410 22:23599522-23599544 GAGCAGGGTGGCAGGGCACGTGG + Intergenic
1181567857 22:23750837-23750859 GGGCAGCGTGTGCGGGTCCGTGG - Exonic
1181643195 22:24215566-24215588 AAGCAGCACGGCTGGGTCAGGGG - Intergenic
1183186398 22:36293891-36293913 GAGCAGTGGGGGTGGGTCCATGG - Intronic
1183439730 22:37816398-37816420 CCGCAGCGTGGCTGGGTACGGGG - Intronic
1184075765 22:42176524-42176546 GGACAGCGTGGCTGCCTCCGTGG + Intronic
1184647505 22:45904030-45904052 GAGCATGGTGGCTGGGTTCAGGG + Intergenic
1185206287 22:49541091-49541113 GAGGAGCGAGGCCGGGTTCGGGG - Intronic
950211499 3:11126838-11126860 GGGCAGCATGGGTGGGTCAGTGG + Intergenic
950345544 3:12288525-12288547 GAGCAGGGTGTCTGGACCCGGGG + Intronic
950446308 3:13040840-13040862 GAGGAGCAGGGCTGGGTGCGGGG - Intronic
950873499 3:16249568-16249590 GAGCAGCCTGGCAGTGTCCAGGG + Intergenic
957078579 3:75619447-75619469 GAGGAGGGAGGCTGAGTCCGGGG + Intergenic
959100906 3:102008623-102008645 CAGCAGCGAGGCTGGGGCAGGGG + Intergenic
961446407 3:126983564-126983586 GTGCGGCGGGGCTGGGACCGCGG + Intergenic
962915256 3:139895524-139895546 GAGCAGAGTAGCTGGGTCATAGG + Intergenic
963251036 3:143103850-143103872 CCCCAGTGTGGCTGGGTCCGGGG - Intergenic
968433697 4:574796-574818 GGGCAGCGGGGCGGGGTCCAGGG - Intergenic
969021662 4:4143420-4143442 GAGGAGGGAGGCTGAGTCCGGGG + Intergenic
969732206 4:8963995-8964017 GAGGAGGGAGGCTGAGTCCGGGG - Intergenic
972065642 4:34939728-34939750 TTGCAGTGTGGCTGGGTCCCGGG + Intergenic
975593631 4:76025570-76025592 TAGAAGAGTGGCTGGGTCAGAGG - Intronic
977064977 4:92303907-92303929 GAGCAGCGGGGCCGGGCCAGAGG - Intronic
978468853 4:109039230-109039252 GAGTAGGGTGGCAGGGTCAGAGG - Intronic
979468869 4:121072070-121072092 TAGCATCTTGGCAGGGTCCGGGG - Exonic
984853328 4:184172414-184172436 GAGGAGCGTAGCTGGGTGCTGGG - Intronic
985970756 5:3376747-3376769 ATGCAGCTTGGCTGGGTCCTCGG + Intergenic
986917947 5:12647597-12647619 AAGCAGGGTGGCTGGGTGTGAGG + Intergenic
988340375 5:29962396-29962418 TCTCAGCGTGTCTGGGTCCGGGG + Intergenic
988816461 5:34839317-34839339 GAGCTGGGAGGCTGGTTCCGGGG + Intronic
994287846 5:97991734-97991756 CAGCAGCGAGGCTGGGTGTGGGG + Intergenic
994801490 5:104382856-104382878 GAGCAGAGTGGCTGGGACACAGG - Intergenic
998130009 5:139647076-139647098 GCGCAGCCTGGCTGTCTCCGAGG - Intergenic
998130686 5:139649770-139649792 GTGCAGCGTGGCAGGCGCCGGGG - Intronic
998150703 5:139756062-139756084 GAGCAGCGTGACTGGGGGTGGGG - Intergenic
1000326664 5:160177530-160177552 GACCAGTGTGGCTGGATCAGAGG - Intergenic
1001563286 5:172683908-172683930 GAGCAGCGCGTCTGGGTCGGCGG - Exonic
1002897699 6:1389187-1389209 GAGGGGCGGGGCTGGGTCCTGGG + Intergenic
1006171773 6:32097254-32097276 GATCAGGGTCGCTGTGTCCGTGG - Intronic
1006801562 6:36763120-36763142 CAGCAGACAGGCTGGGTCCGTGG + Intronic
1007377965 6:41469316-41469338 GAGCGGAGGGGCTGGGTCTGTGG - Intergenic
1007431430 6:41779670-41779692 GAGCACCGGGGCTGGGGGCGGGG - Intronic
1015702323 6:136050060-136050082 CAGCAGCGTGGCTGAGTCAATGG - Intronic
1016469726 6:144362320-144362342 GAACAACATGGCTGGGTCCTGGG - Intronic
1017293012 6:152763029-152763051 AGGCAGAGTGGTTGGGTCCGAGG + Intergenic
1018798259 6:167203637-167203659 AAGGAGCGTGGCTGGCCCCGTGG + Intergenic
1018814452 6:167320539-167320561 AAGGAGCGTGGCTGGCCCCGTGG - Intergenic
1018869518 6:167770429-167770451 GAGGAGCTGGGCTGGGTCCCAGG - Intergenic
1019828438 7:3301945-3301967 GAGCAGCGAGAGTGTGTCCGGGG + Intronic
1020069589 7:5217582-5217604 GAGCAGTGGGGCTGGGCGCGGGG - Intronic
1020309075 7:6855450-6855472 GAGGAGCGAGGCTGAGTCCGGGG + Intergenic
1021282685 7:18739983-18740005 GAGCAGCCTGGCTGGGGAAGGGG - Intronic
1021719862 7:23494705-23494727 GAGACGCATAGCTGGGTCCGGGG + Intergenic
1022465761 7:30652507-30652529 AAGGATCGTGGCTGGGTCTGAGG - Intronic
1024976309 7:55117009-55117031 GAGTGGCGTTGCTGGGTCAGAGG + Intronic
1025022424 7:55490049-55490071 GAGGAGCGGGGATGGGTCTGAGG + Intronic
1026447967 7:70501980-70502002 AAGCAGCCTGGCTGGGTGGGAGG - Intronic
1028836427 7:95379638-95379660 GAGCAGCGAGGCTGGGGGAGGGG + Intronic
1029745655 7:102514503-102514525 GAGCCGGGTGGCTGGATCAGAGG + Intronic
1029763594 7:102613482-102613504 GAGCCGGGTGGCTGGATCAGAGG + Intronic
1032538749 7:132686033-132686055 TCTCAGTGTGGCTGGGTCCGGGG - Intronic
1034716723 7:153250120-153250142 GAGAACCTTGGCTGGGTCTGTGG + Intergenic
1035376445 7:158410004-158410026 GAACAGCCTGGGTGGCTCCGAGG + Intronic
1036545510 8:9765800-9765822 AAGCAGCGTGGCAGGGACGGTGG + Intronic
1036708076 8:11059734-11059756 GAGCCGCGGGGCGGGGTCCGGGG - Intronic
1038401488 8:27287775-27287797 GGGCGACGTGGCTGGGTCCGAGG + Exonic
1039474296 8:37831365-37831387 GGGCAACGTGGCTGGGCCCAAGG + Intronic
1039491029 8:37947539-37947561 GAGCAGCAGGGCTGGGACCCAGG - Intergenic
1040309962 8:46231751-46231773 GAGCAGGGTGGCTGTGTCTCTGG + Intergenic
1040914969 8:52559391-52559413 GAGGAGTGTGGCTGGGTTTGGGG + Intronic
1041045068 8:53880716-53880738 GAGCAGTGGGGCTGCGGCCGGGG + Intronic
1043502732 8:80873573-80873595 GGACTGCGTGGCCGGGTCCGAGG + Intronic
1045272075 8:100670609-100670631 TCTCAGTGTGGCTGGGTCCGGGG - Intergenic
1047000978 8:120571999-120572021 CAGCAGCGGGGGTGGGGCCGGGG - Intronic
1048048205 8:130792925-130792947 AACCAGCGTGGCAGGGTCAGTGG - Intronic
1049563547 8:143325421-143325443 GAGCCGCCTGGCTTGTTCCGTGG - Exonic
1049685977 8:143939490-143939512 GAGCACCGTGCCTGAGGCCGAGG - Intronic
1049694535 8:143976907-143976929 GAGCGGCGGGGCTGGGGCCCGGG + Intergenic
1049731369 8:144180280-144180302 GCGCAGTGTGGCAGGGTCCCAGG - Exonic
1050932689 9:11349673-11349695 TTCCAGTGTGGCTGGGTCCGGGG + Intergenic
1053303671 9:36969249-36969271 GAGCAGCCTGGGTGGGCCGGAGG - Intronic
1053600075 9:39601893-39601915 TCTCAGCGTGGCTGGGTCCGGGG - Intergenic
1053857728 9:42355749-42355771 TCCCAGCGTGGCTGGGTCCGGGG - Intergenic
1054155100 9:61634520-61634542 GCGCAGGGTGGCTGGGTGTGGGG + Intergenic
1054253450 9:62740491-62740513 TCTCAGCGTGGCTGGGTCCGGGG + Intergenic
1054567566 9:66774990-66775012 TCCCAGCGTGGCTGGGTCCGGGG + Intergenic
1054869313 9:70034827-70034849 CAGCATCGTGGCTGTGTCAGAGG - Intergenic
1056746799 9:89310597-89310619 CCGCGGCGTGGCTGTGTCCGGGG - Intergenic
1056790116 9:89619878-89619900 GAGCAGCTTGGCTGGCTGCAGGG - Intergenic
1056873257 9:90304564-90304586 GAGCAGTGGGGTTGGGTCAGTGG - Intergenic
1057079286 9:92160247-92160269 GAGCACAGTGGCTGGGACCCAGG + Intergenic
1057869491 9:98707883-98707905 GTGCAGCGTGGCTGGGCGCCTGG - Intronic
1060196082 9:121624206-121624228 GGGCAGCCCCGCTGGGTCCGTGG - Intronic
1061508613 9:131046957-131046979 GCGCCGCGTGTCTGGGTCCTGGG + Intronic
1061680898 9:132242044-132242066 GAGCAGGGTGGCGGGGCGCGGGG - Exonic
1061898087 9:133658838-133658860 GAGCAGCGGGGCGGGGGCGGGGG - Exonic
1062107514 9:134763997-134764019 GGGCAGCGTGGTGGGGTCTGGGG + Intronic
1062107540 9:134764077-134764099 GGGCATCGTGGTGGGGTCCGGGG + Intronic
1062203362 9:135321084-135321106 GAGCAGGGTGTCTGGGGCCGTGG - Intergenic
1062333643 9:136055470-136055492 GAGCTGCCTGGCTGGGCCCCAGG - Intronic
1203787548 EBV:136401-136423 TAGCATGGTGGCTGGGTCTGTGG - Intergenic
1185551048 X:982655-982677 GACCAGCGTGGCCGTGTCTGCGG + Intergenic
1195797174 X:108663576-108663598 GAGCAGGGTGTTTGGGTCAGGGG + Intronic
1197676660 X:129337460-129337482 CAGCAGCGTGGCTGGGGGAGGGG + Intergenic
1200080847 X:153575631-153575653 GAGCCACGGGGCTGGGGCCGGGG + Intronic
1201057600 Y:10011384-10011406 CAGCATTGTGGCTGGGTCCATGG - Intergenic
1202102987 Y:21330008-21330030 CAGCAATGTGGCTGGGTCCATGG + Intergenic
1202189279 Y:22224151-22224173 CAGCAGTGTGTCTGGGTCCATGG + Intergenic