ID: 934655303

View in Genome Browser
Species Human (GRCh38)
Location 2:96114251-96114273
Sequence CCCTGGCAGGCGCTGGGATG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 584
Summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 522}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934655303_934655311 -3 Left 934655303 2:96114251-96114273 CCCCATCCCAGCGCCTGCCAGGG 0: 1
1: 0
2: 3
3: 58
4: 522
Right 934655311 2:96114271-96114293 GGGACCGCGAGTGCCTAGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 40
934655303_934655312 -2 Left 934655303 2:96114251-96114273 CCCCATCCCAGCGCCTGCCAGGG 0: 1
1: 0
2: 3
3: 58
4: 522
Right 934655312 2:96114272-96114294 GGACCGCGAGTGCCTAGCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934655303 Original CRISPR CCCTGGCAGGCGCTGGGATG GGG (reversed) Exonic
900109189 1:998485-998507 TCCTGAGCGGCGCTGGGATGAGG - Intergenic
900122696 1:1055621-1055643 CCCTCGCAGGGCCTGGGGTGTGG - Exonic
900351676 1:2238024-2238046 CTGTGCCAGGCGCTGGGCTGTGG + Intronic
900548327 1:3241158-3241180 CCCAGGCGGGCGGTGAGATGGGG + Intronic
900626237 1:3609951-3609973 CCCTGGCTGGTCCTGGGAGGAGG + Intronic
900783399 1:4632267-4632289 CCATGTGAGGCTCTGGGATGAGG + Intergenic
900948423 1:5844182-5844204 CCCTGGCAGGTGCTGGTGTGGGG - Intergenic
901204876 1:7488423-7488445 CCCTGAGAGGGGCTGGGATCAGG + Intronic
901510331 1:9715311-9715333 ACCTGGGAGGTGCTGGGATCTGG - Intronic
901624093 1:10613768-10613790 CCCTGGCTGGTGGTGGCATGAGG + Intronic
902340980 1:15783504-15783526 CCATGGCCTGTGCTGGGATGGGG + Intronic
902690225 1:18106508-18106530 CCTTGGGAGGCGATGGGGTGAGG + Intergenic
902876356 1:19343100-19343122 CCCAGGCAGTGGCTGGGAAGTGG - Intronic
903668553 1:25022372-25022394 CCCTGTGAGGCCCTGGGGTGGGG + Intergenic
903850330 1:26301864-26301886 CCCAGGCTGGGGCTGGGATTTGG - Intronic
903948755 1:26981341-26981363 TGCTGGCAAGGGCTGGGATGGGG - Intergenic
904034117 1:27549977-27549999 CCGTGGCAGCCGCTGGGGTCGGG - Exonic
904605712 1:31696544-31696566 CCCTGGCCGGCGCTGGGCCCAGG + Intronic
905569226 1:38991057-38991079 CCCTGGGAGGGGCGGGGGTGGGG + Intergenic
905828593 1:41046389-41046411 ACCAGGTAGGAGCTGGGATGGGG - Exonic
906157950 1:43625184-43625206 CCCAGGCAGGCTCTGCGCTGAGG + Intergenic
906702040 1:47866644-47866666 CCAAGGCATGCGCTGGAATGAGG + Intronic
906751522 1:48267131-48267153 CCATCGCAGGCCCTGAGATGGGG - Intergenic
907274859 1:53311366-53311388 CCCTGGCAGTTCCTGGGGTGTGG + Intronic
908117085 1:60950916-60950938 TCCTGGCAGGAGCTTGCATGGGG - Intronic
910127534 1:83860672-83860694 CCCTGGCGGGATCTGGGACGGGG - Intergenic
912475031 1:109929570-109929592 CTCTGGCAGGTGCTGGAAGGAGG - Exonic
915001861 1:152601214-152601236 CCTTGGCAGGGGCAGGGATGAGG - Intergenic
915469024 1:156114776-156114798 TCCTGGCAGGCGTGGGGATCTGG - Exonic
915922852 1:159990192-159990214 CCCTGGCAAGGGGTGGGGTGTGG - Intergenic
916045870 1:160999580-160999602 CCATGCCAGGCCCTGGGATGGGG + Intronic
916090625 1:161305652-161305674 CTCTGGCAGGGCCTGGGGTGGGG + Exonic
918349307 1:183636534-183636556 TCCGGGCAGGCGCTGGGGTCGGG + Intronic
918437741 1:184533787-184533809 CCCTGGCCGGGGCTGGGGAGTGG + Intronic
918963334 1:191307158-191307180 CCCTGGGAGCTGCTGTGATGGGG - Intergenic
919453845 1:197800801-197800823 CCCTGGGAGCCACTGTGATGAGG + Intergenic
919873447 1:201842430-201842452 CCCTGTCAGAGGGTGGGATGGGG + Intronic
920034858 1:203059279-203059301 CCCTGGCAGACCCTGGCCTGTGG - Intronic
920111335 1:203589398-203589420 GCCGAGCAGGGGCTGGGATGTGG - Intergenic
920385498 1:205568366-205568388 CCCTGGAAGGGCCTGAGATGAGG - Intergenic
920491434 1:206418481-206418503 CCCTAGCAGGTGCTGAGCTGGGG - Intronic
921390154 1:214607739-214607761 CCCAGGCAAGCGCAGGGCTGGGG + Intronic
922674915 1:227544087-227544109 TCCTGGCAGGGGCTGAGCTGGGG - Intergenic
923698896 1:236281745-236281767 GCCGGGCAGGCGCTGGGCAGGGG - Exonic
924955272 1:248920309-248920331 CCCTGACAGGTCCTGGTATGAGG + Intergenic
1063665896 10:8060392-8060414 GCCTGGCAGGGGCTGGGCTTGGG + Intronic
1065125112 10:22566560-22566582 TGCTGGCCGGAGCTGGGATGTGG - Intronic
1065991181 10:31011965-31011987 CCCTGGCAGGGGCTTGTATAAGG - Intronic
1067723637 10:48749860-48749882 GCCTGGCAGGGGCTGGGAGAAGG - Intronic
1068080623 10:52314163-52314185 CGCTGGGAGGGGCTGGGAGGGGG - Intergenic
1068955346 10:62815599-62815621 CCCGGGCGAGCGCAGGGATGGGG - Intronic
1069682684 10:70296516-70296538 ACCAGGCAGGCACTGGTATGTGG - Intergenic
1069867892 10:71515006-71515028 CCCTGGGAGGAGCAGGGAGGGGG - Intronic
1069927408 10:71860394-71860416 CCCTGTCACCCGCTGGGCTGTGG + Intergenic
1070780177 10:79132975-79132997 CCCTCGCAGGCTCTGGGGTGGGG + Intronic
1070788712 10:79177116-79177138 CCCTGCCAGGCGCTGTGAGCAGG - Intronic
1071405213 10:85323395-85323417 CCCTTGCCAGTGCTGGGATGAGG + Intergenic
1073042193 10:100615242-100615264 CCCAGCCAGGAGCTGTGATGGGG + Intergenic
1073208652 10:101781685-101781707 GCCTAGCAGGCTCTGGGAAGGGG - Intronic
1073432298 10:103494321-103494343 GCCGGGCAGGCGCTGAGGTGCGG - Exonic
1075071573 10:119323430-119323452 GCCTTGCAGCTGCTGGGATGGGG + Intronic
1075344582 10:121672919-121672941 CCATGGGAGGCGCTGTGGTGGGG + Intergenic
1075428435 10:122361034-122361056 CCCTGACAGGCACTGGGAAGAGG + Intergenic
1075753417 10:124791951-124791973 CCCGCGCTGGGGCTGGGATGGGG + Intergenic
1075998631 10:126897581-126897603 CCCTAGCAGGCAGTGGGAAGGGG + Intergenic
1076738168 10:132467964-132467986 CCGTGGCTGGCCCTGGGAGGGGG - Intergenic
1076791062 10:132776963-132776985 CCCTGGCCGGCGGTGGGTGGTGG + Intronic
1076792455 10:132784652-132784674 CCCGGGCAGGCGCGAGGAGGCGG - Intergenic
1076993833 11:289086-289108 CCCGGGCGGTCGCTGGGAGGCGG - Intergenic
1077050638 11:565030-565052 CCCAGGCAGGGGCTGGGCTGTGG - Intergenic
1077081366 11:726034-726056 CCCGGGCAGGTGCTGGGAGGCGG + Intronic
1077185406 11:1233500-1233522 TCCTGGCAGGGGCTGCCATGTGG - Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077226400 11:1440713-1440735 CTGTGGGAGGCCCTGGGATGAGG + Intronic
1077608558 11:3628702-3628724 ACCTGGCAGGGGGTGGGATGTGG - Intergenic
1078059426 11:8033656-8033678 CCGTGCCAGGCCCTGGGTTGGGG - Intronic
1078189030 11:9076207-9076229 CCCTGCCAGGGGCAGGGAGGAGG + Intronic
1080442933 11:32312032-32312054 CCCAGTCAGGGGCCGGGATGTGG - Intergenic
1080601969 11:33829328-33829350 CCTTGGGAGGCGCTGGGACCTGG - Intergenic
1083236910 11:61356928-61356950 CACTGCCAGGTGCTGGGGTGGGG - Intronic
1083639780 11:64139299-64139321 TCCTGGCAGGGGCAGGGACGCGG - Intronic
1083889854 11:65590284-65590306 CCTTGGGAGGAGCTGGGAGGAGG + Intronic
1084088143 11:66864179-66864201 CCCTGTGAGGAGCTGGGAGGGGG + Intronic
1084396505 11:68914387-68914409 CCCTCGCAGGGCGTGGGATGGGG + Intronic
1084591761 11:70094400-70094422 CACTGGCAGGGGCTGGGGAGAGG + Intronic
1084979803 11:72823001-72823023 CCCTGGCAGCCTCTGGGGTGGGG - Intronic
1085779356 11:79394316-79394338 CCTTGGGAGCTGCTGGGATGCGG - Intronic
1089845049 11:121452049-121452071 CCCTCCCTGGCGCGGGGATGGGG - Intergenic
1090021180 11:123130340-123130362 CCCTGGGAGGTGCTGGGAAATGG + Intronic
1090137089 11:124209943-124209965 CCCTGGCCCTCGGTGGGATGAGG - Intergenic
1090228082 11:125083541-125083563 CCCTGGCAAGCTCTGGGATCTGG - Intronic
1091216708 11:133906767-133906789 CCCTGGGATGCACTGGGATGTGG - Intergenic
1091447748 12:553669-553691 CCCTGGAAGGGGCTGGCATGGGG + Exonic
1092541295 12:9421052-9421074 CCCTGCCGGGGGCAGGGATGTGG - Intergenic
1092793174 12:12087027-12087049 GCCTGGCAGAGGCCGGGATGTGG - Intronic
1093652021 12:21657286-21657308 CCCTTGCACTCGCTGGGATGAGG - Intronic
1094040247 12:26114399-26114421 CGCTGGCGGGCGGCGGGATGGGG - Intergenic
1094361791 12:29638775-29638797 CCCTGGCAGGGTGTGTGATGGGG - Intronic
1095779339 12:46041902-46041924 CCCTGACAGGCACTGGTATGTGG - Intergenic
1095944892 12:47748240-47748262 ACCTTGCAGGTGGTGGGATGTGG - Intronic
1095946755 12:47758205-47758227 CCCTGCCAGGAGCTGGGGGGAGG + Intronic
1095961617 12:47838484-47838506 CCCTGGGAGGCCCTTGGGTGAGG + Intergenic
1096519433 12:52175883-52175905 CCCTGGCTGGGGCTTGGCTGGGG + Intronic
1096523045 12:52194793-52194815 GCCTGGCAGGGGTTGGGAGGTGG + Intergenic
1096553703 12:52390629-52390651 TCCTGGCAGGGGCTGGAATTGGG - Intergenic
1096578542 12:52569803-52569825 CCACAGCAGGCTCTGGGATGAGG - Intronic
1096592169 12:52667612-52667634 CCCTGGGAGCCGCTGCGTTGTGG + Intergenic
1096801960 12:54116369-54116391 CCTTGGCAGGAGATGGGAGGAGG + Intergenic
1097170980 12:57112451-57112473 CCATAGCAGGGGCTGGGCTGAGG + Intronic
1097187123 12:57201964-57201986 CCCTGGCAGGTGGAGGGCTGGGG + Intronic
1097361208 12:58660322-58660344 CCCTGACAGGCCCTGGTGTGTGG + Intronic
1098290448 12:68952610-68952632 CCCAGATAGGTGCTGGGATGAGG - Intronic
1099022401 12:77422953-77422975 CCCTGACAGGCTCTGGTGTGTGG + Intergenic
1099499185 12:83389852-83389874 CCCTCGCAGGGCGTGGGATGGGG - Intergenic
1099969355 12:89484865-89484887 CACTGGCAGGTGCGTGGATGGGG + Intronic
1100797676 12:98199323-98199345 CCCTGGCAGGCCCTGGTGTGTGG + Intergenic
1101606978 12:106254557-106254579 AACTGGCATGTGCTGGGATGTGG - Intronic
1102762582 12:115401354-115401376 CTCTGGCAGGCACTGTGCTGGGG - Intergenic
1102991507 12:117319567-117319589 CAGTGGCAGGAGCTGGGAAGGGG - Intronic
1103212390 12:119176401-119176423 CCTGGGCAGGGGCTGGGGTGAGG - Intergenic
1103848522 12:123916115-123916137 CCCTGGCAGGCTGAGGGAAGAGG - Intronic
1103900916 12:124303317-124303339 CCCCGGGAGCCGCTGGGGTGGGG - Intronic
1103916890 12:124380419-124380441 CACTGGCAGGGGCAGGGCTGTGG - Intronic
1104926476 12:132316594-132316616 CCCTGGCAGGAGGAGGGATGAGG - Intronic
1105981336 13:25519276-25519298 CACTGGCTGGGGCTGGGAGGAGG - Intronic
1106470464 13:30049685-30049707 GCCTGGCAGGGGATGGGAAGGGG + Intergenic
1106571506 13:30932539-30932561 ACCTGGCCGGCGCGGGAATGGGG - Intergenic
1107958519 13:45540026-45540048 TCCTGGGAGGAGCTGGCATGTGG + Intronic
1112183915 13:97110471-97110493 CCAAGGAAGGGGCTGGGATGAGG + Intergenic
1112503147 13:99957330-99957352 CACTGGCTGGGGCTGGGCTGGGG + Intergenic
1113579943 13:111421510-111421532 GCCTGGCAGGAGCAGGGGTGAGG + Intergenic
1114635890 14:24186563-24186585 CCCAGGCAGGAGCTGGGGTGAGG + Intronic
1114777326 14:25498647-25498669 CCAGGGCAGGGGCTGGGGTGGGG + Intergenic
1117881208 14:60315397-60315419 GCCTGGGAGGCTCTGGGATGGGG - Intergenic
1118473263 14:66094295-66094317 CCCTGGGAGCCGCAGTGATGGGG - Intergenic
1118561237 14:67085872-67085894 TGGTGGCAGGTGCTGGGATGAGG - Intronic
1119223443 14:72926875-72926897 ACCTGGCGGGGGCTGGGCTGCGG + Intronic
1119320869 14:73729596-73729618 CCCTGGCAGGAGCGGGGCTGGGG - Intronic
1119466627 14:74863471-74863493 CCCAGGCAGGGGCTGGCATCAGG + Exonic
1119729136 14:76940084-76940106 CACTGGCTGGGGCTGGGCTGAGG - Intergenic
1120840761 14:89083040-89083062 CTGTGGCAGGCTCTGGGAGGGGG + Intergenic
1121082950 14:91123372-91123394 CCCTGGCAGGCCCTGGCAAATGG + Intronic
1121587009 14:95069329-95069351 CCCTCGCAGGCGCTGGGCTCAGG + Intergenic
1122115002 14:99523190-99523212 CCCAGGCTGGGGCTGGGCTGGGG + Intronic
1122267153 14:100552067-100552089 CCTTGGCAAGGGCTGGGAGGAGG - Intronic
1122293491 14:100692334-100692356 CCCTGCCCGGCGCCGGGCTGGGG + Intergenic
1122326762 14:100885309-100885331 CCCTGGCAGGCTCAGGGCTCTGG + Intergenic
1122886076 14:104711025-104711047 CCCTGGCACCAGGTGGGATGGGG - Intronic
1122918061 14:104867899-104867921 CCCAGGCAGGGCCTGGGGTGAGG - Intronic
1122962816 14:105105428-105105450 GCCTGCCAGGAGCTGGGAGGAGG + Intergenic
1123003837 14:105311972-105311994 TCCTGCCAGGAGCTGGGCTGAGG - Exonic
1123053685 14:105559649-105559671 CCGCGGCAGGCGCTGGGGAGGGG + Intergenic
1123078260 14:105680048-105680070 CCGCGGCAGGCGCTGGGGAGGGG + Intergenic
1123411935 15:20067839-20067861 CCCGAGCAGGAGCTGGGCTGAGG + Intergenic
1123506242 15:20942763-20942785 CCATGGCAGGGGCAGGGCTGCGG + Intergenic
1123521279 15:21074958-21074980 CCCGAGCAGGAGCTGGGCTGAGG + Intergenic
1123563468 15:21516467-21516489 CCATGGCAGGGGCAGGGCTGCGG + Intergenic
1123578364 15:21695040-21695062 CCCGAGCAGGAGCTGGGCTGAGG + Intergenic
1123599720 15:21953753-21953775 CCATGGCAGGGGCAGGGCTGCGG + Intergenic
1123614989 15:22137522-22137544 CCCGAGCAGGAGCTGGGCTGAGG + Intergenic
1123671505 15:22664290-22664312 CCCTGACAGGCGGTGCGACGAGG + Intergenic
1124323544 15:28737514-28737536 CCCTGACAGGCGGTGCGACGAGG + Intronic
1124617206 15:31250274-31250296 CCCTGGCAGGGACTGGAATCAGG - Intergenic
1127155886 15:56123898-56123920 CCGTGGCAGGTGCTGGGAGATGG + Intronic
1128240412 15:66097440-66097462 CCCAGGCAGTCACTGGCATGGGG - Intronic
1128545083 15:68561271-68561293 GCCTGGGAGGAGCTGGGAGGGGG - Intergenic
1128866844 15:71120654-71120676 CCCTGGCAGGAGATTAGATGGGG - Intronic
1129109283 15:73328279-73328301 CCATGGCAGGAGCAGGCATGGGG + Intronic
1129194680 15:73956744-73956766 GCCTGGCAGGAGCTGGGAAATGG - Intergenic
1129252514 15:74316630-74316652 CACTGGCTGGCACTGAGATGTGG - Intronic
1129300260 15:74621338-74621360 CCAGGGCAGGAGCTGGCATGGGG + Intronic
1129377899 15:75145597-75145619 CCCTGGGAGCCACTGTGATGAGG - Intergenic
1130010343 15:80147986-80148008 CCCAGACAGCCGCTGAGATGTGG + Intergenic
1130047205 15:80454502-80454524 CCCTGGGAGCTGCTGGAATGTGG + Intronic
1130680796 15:85994660-85994682 CCCTGACAGGCCCTGGTGTGTGG + Intergenic
1131058635 15:89391119-89391141 CCCTTGCAGGTCCTGGGATGGGG + Intergenic
1131160493 15:90102076-90102098 CCGTGCCAGGCGCTGGGGTGGGG - Intronic
1131687591 15:94787240-94787262 GCCTGACAGGGGTTGGGATGGGG - Intergenic
1202971826 15_KI270727v1_random:243604-243626 CCATGGCAGGGGCAGGGCTGCGG + Intergenic
1202987234 15_KI270727v1_random:429285-429307 CCCGAGCAGGAGCTGGGCTGAGG + Intergenic
1132481063 16:166305-166327 TCCTGGCAGGCGCTCAGGTGCGG - Exonic
1132579325 16:677865-677887 ACCTGGCAGGCGCGGTGGTGGGG + Exonic
1132650885 16:1021034-1021056 CCCTGGCGTGAGCTGGGACGGGG - Intergenic
1132750242 16:1454285-1454307 CCCCGGGTGGCCCTGGGATGAGG + Intronic
1132756989 16:1490336-1490358 CCCTCGAAGGCTCTGGGCTGGGG - Intergenic
1132767431 16:1541579-1541601 CCCTTGAAGGCGCTGGCGTGGGG - Intronic
1133125301 16:3642344-3642366 TCCTGCCAGGCCATGGGATGTGG + Intronic
1133270512 16:4608976-4608998 AGCAGGCAGGCGCTGGGAGGCGG + Exonic
1133284192 16:4683021-4683043 CCCAGGCGGGCAGTGGGATGGGG - Intronic
1133868741 16:9668530-9668552 CCCTGGCAGGAGATGAGAAGGGG + Intronic
1133955604 16:10440912-10440934 CCCTGACAGGCCCTGGTGTGTGG + Intronic
1134539917 16:15055986-15056008 CCCAGGCAGGCCCAGGGAGGCGG + Exonic
1136023791 16:27456903-27456925 CCCTGGAAGGCGGTGTGATGGGG + Intergenic
1136139906 16:28281853-28281875 CCCAGGCAGGCTCTGGGGGGTGG + Intergenic
1136707191 16:32200638-32200660 CCCAGGCAAGCGCAGGGCTGGGG - Intergenic
1136760719 16:32728779-32728801 CCCAGGCAAGCGCAGGGCTGGGG + Intergenic
1136807384 16:33141607-33141629 CCCAGGCAAGCGCAGGGCTGGGG - Intergenic
1137057191 16:35751381-35751403 GCCTGGCAGGGGCTTGGATGTGG + Intergenic
1137057507 16:35752631-35752653 GCCTGGCTGGGGCTTGGATGGGG + Intergenic
1137505988 16:49054057-49054079 CCCTGGGAGACACTGGGGTGGGG - Intergenic
1137541440 16:49364942-49364964 CCTTGTCAGGGGCTGGGGTGCGG - Intergenic
1137671677 16:50282954-50282976 TCCTGGCTGGGGCTGGGCTGTGG + Intronic
1138339442 16:56279113-56279135 CCCCGGCAGGTGCTGGGAGTGGG - Intronic
1138561161 16:57801925-57801947 CCCTGGCAGGGCCTGGGGCGGGG - Intronic
1138630709 16:58292268-58292290 CCCTGGCAGGTGCTGAGGTAGGG + Intronic
1138873356 16:60919848-60919870 CCCTGGCAGGTGCTGGAGGGAGG + Intergenic
1139283399 16:65788885-65788907 CACTGGCAGGCACTTGGATGAGG + Intergenic
1139435058 16:66932144-66932166 CCCTGGCAGGAGCTGGGACCAGG + Exonic
1140614734 16:76648747-76648769 CCCTGGCAGGGCATGCGATGAGG + Intergenic
1140616363 16:76669117-76669139 CCCAGGCTGGGGGTGGGATGGGG - Intergenic
1141280826 16:82628197-82628219 CTCTGGCAGGCGTTGGGACTTGG + Intronic
1141599937 16:85119497-85119519 ACCTGGCAGGGGCTGGGCGGAGG + Intergenic
1141615550 16:85207591-85207613 CCCCTGCAGGCGCTGGTGTGAGG + Intergenic
1142033998 16:87852539-87852561 CCCCAGGAGGCGCTGAGATGTGG + Intronic
1142042663 16:87905093-87905115 TCTGGGCAGGCGCTGGGCTGGGG - Intronic
1203062871 16_KI270728v1_random:989093-989115 CCCAGGCAAGCGCAGGGCTGGGG + Intergenic
1142620945 17:1165418-1165440 CCCTGCCTGGCGCTGGGACCTGG + Intronic
1142940806 17:3378586-3378608 AGCTGGCAGGGGCTGGGAAGAGG - Intergenic
1143312676 17:6005766-6005788 CCCTGACAGGCCCTGGTATGTGG - Intronic
1143888980 17:10087904-10087926 CCCTGGCTGGAGCGAGGATGGGG - Intronic
1144248578 17:13393421-13393443 CCTGGGCAGGCTCTGGGATGAGG + Intergenic
1144783668 17:17820187-17820209 CCCTGGCAGGGGCTGTGGGGTGG + Exonic
1145190970 17:20842078-20842100 CCCAGGCAAGCGCAGGGCTGGGG - Intronic
1145294076 17:21574464-21574486 CCCTGGGAATCGCTGTGATGGGG + Intergenic
1145369759 17:22298722-22298744 CCCTGGGAATCGCTGTGATGGGG - Intergenic
1145902386 17:28497217-28497239 GCTTGGCAGGCACTGGGCTGTGG - Exonic
1146624366 17:34424538-34424560 CTCTGGGAGGTGCTGGGATGAGG - Intergenic
1147531400 17:41281586-41281608 CCATGACAGGCCCTGGGGTGTGG - Intergenic
1147537943 17:41333116-41333138 CCCTGGGAAATGCTGGGATGGGG - Intergenic
1147992554 17:44343994-44344016 GCCTGGCACGGGCTGGGCTGTGG - Intergenic
1148552914 17:48561241-48561263 CCCTGCCAGGCACTGGGCTAAGG - Intronic
1148586778 17:48786641-48786663 CCATGGCAGGTGCTGGGGAGAGG + Intronic
1148682763 17:49484184-49484206 CCATGGCGGGGGCTGGGGTGGGG + Intergenic
1149455407 17:56783978-56784000 GCCTGTCAGGGGGTGGGATGGGG - Intergenic
1149553898 17:57559598-57559620 ACCAGGCAGGCACTGGGGTGAGG + Intronic
1150209375 17:63433831-63433853 CCCTGGGAAGCTCTGAGATGAGG - Exonic
1150315100 17:64162676-64162698 CCCTGCCAGGAGCTGGGAGGTGG + Intronic
1150641478 17:66952785-66952807 GCCGGGCAGGGCCTGGGATGGGG - Intergenic
1151155761 17:72122257-72122279 CCTTGGCAGGAACTGGGAGGCGG + Intronic
1151163558 17:72185687-72185709 CCTTGGCAAGTGCTGGGAAGAGG - Intergenic
1151213675 17:72562940-72562962 GGCTGGCAGGGGCTGGGCTGGGG - Intergenic
1151309510 17:73284901-73284923 CCAGGGCAGGAGCTGGGGTGGGG + Exonic
1151686334 17:75648981-75649003 CCATGGCCGGCTCTGGGACGGGG + Intronic
1151852728 17:76700660-76700682 CTGTTGCAGGAGCTGGGATGTGG + Intronic
1152335927 17:79700248-79700270 CCACCGCAGGCCCTGGGATGGGG + Intergenic
1152735563 17:81995357-81995379 CCCTGGCTGGGGCTGTGACGGGG + Intronic
1152792877 17:82291751-82291773 CCCTGGCAGGCTCCGGGCTCAGG - Intergenic
1152800828 17:82329959-82329981 CCATGTCAGGTTCTGGGATGAGG + Intronic
1152811298 17:82384041-82384063 CCCTGGAAGGCCCTGGGCAGTGG + Intergenic
1152971986 18:170849-170871 GCCTGTCAGGCAGTGGGATGTGG + Intronic
1153675291 18:7451715-7451737 CTCTGGCAGGTGCTGTGCTGTGG + Intergenic
1153915474 18:9741015-9741037 CCCTGGCAGGGGCTGCATTGAGG + Intronic
1155349371 18:24891586-24891608 TACTGGCAGGTGCTGGGTTGAGG + Intergenic
1155994110 18:32311962-32311984 ACATGGCAGGGGCTGGGAAGTGG + Intronic
1156498250 18:37540272-37540294 ACCTGGGAGGCTCTGGGCTGGGG - Intronic
1156676242 18:39530042-39530064 CCCTGGCAGGGTGTGCGATGGGG - Intergenic
1157608112 18:48939060-48939082 CACAGGCAGGCTCTGGGATAGGG - Intronic
1157656896 18:49399346-49399368 GCCTGGCATGCCCTGGGAAGGGG + Intronic
1157728459 18:49983558-49983580 TCCTGGCAGGGGCCGGGATGGGG - Intronic
1158241785 18:55386114-55386136 ACCTGGGAGGCGCTGGGAGTAGG - Intronic
1158523809 18:58194600-58194622 CCCTGGCAGGGTTTGGGCTGTGG + Intronic
1159452617 18:68621576-68621598 GCCTGTCAGGGGCTGGGAGGAGG + Intergenic
1160236064 18:77087749-77087771 TCCAGGCAGGCGCTGGGATGGGG + Intronic
1160251916 18:77210381-77210403 CCCTGGCAGGAGTGGGGGTGGGG + Intergenic
1160276509 18:77442580-77442602 CCCTCCCAGGCGCTCAGATGGGG + Intergenic
1160460877 18:79037260-79037282 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460895 18:79037336-79037358 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460930 18:79037488-79037510 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160734389 19:655580-655602 TCCTGGCTGGCCCTGGGAAGTGG - Intronic
1160995232 19:1879345-1879367 CCCAGGCAAGCGCAGGGCTGGGG + Intronic
1161210664 19:3063554-3063576 CCCTGGAAGGCTGTGGGAGGAGG + Intergenic
1161506174 19:4644939-4644961 CCCTGGGAGTCGGTGGGATGAGG + Intronic
1161588698 19:5118931-5118953 CCCTGGCAGGCCCTGGGGTGTGG + Intronic
1161768486 19:6219256-6219278 CGCTGGCAGGGGCTGGTTTGAGG - Intronic
1161916460 19:7232093-7232115 CACTGGAAAGGGCTGGGATGAGG + Intronic
1162498192 19:11035160-11035182 CCCTGCCTGGCGCTGGCCTGCGG - Intronic
1162719586 19:12654369-12654391 CCCTGGAAGGCCCTGGTAAGAGG - Intronic
1163207746 19:15815839-15815861 CCCTGGCAGGCGGGGGGAATGGG - Intergenic
1163748482 19:19061725-19061747 ACCTGCCAGGCCCTGGGAGGGGG - Intergenic
1164603489 19:29579339-29579361 CCCTGGCAGATGATGGGGTGAGG - Intergenic
1165295770 19:34925031-34925053 CCCTGGCAGGGCGTGCGATGGGG + Intergenic
1165320424 19:35081400-35081422 CCCAGGCAGAAGTTGGGATGAGG + Intergenic
1165761929 19:38326689-38326711 CAGTGACAGGCGCTGGGCTGAGG - Exonic
1165812249 19:38618617-38618639 GCCGGGCAGGGGCTGGGGTGAGG - Intronic
1165958320 19:39515589-39515611 CCCTGCCAGGAGCTGGGCTGGGG - Exonic
1166183360 19:41123905-41123927 CCCTGGCAGGCACATGGCTGGGG - Intronic
1166197866 19:41218853-41218875 GCCTGGCTGGGGCTGGGCTGGGG + Intergenic
1166523707 19:43497937-43497959 CCCAGGCAGGCTCTGAGATATGG - Intronic
1167100089 19:47399307-47399329 CCCTGCCTGGTGCTGGGAAGGGG - Intergenic
1167291008 19:48625110-48625132 CCCTTGCAGGCGCTCGCATGTGG + Intronic
1167299698 19:48671623-48671645 GCCTGGCAGGCCCTGGGGAGGGG + Intronic
1167453369 19:49585157-49585179 ACCAGGCAGCTGCTGGGATGGGG - Intronic
1168155959 19:54473032-54473054 CCCTGGCAAGCCCTGGCATAAGG + Intronic
1168311649 19:55463791-55463813 CTCAGGCTGGCGCTGGCATGGGG + Intergenic
1168349146 19:55666120-55666142 CTCTGGCAGGGGCTGAGCTGAGG + Intronic
1168353570 19:55689385-55689407 CCCTGGCAGGGGCAGGGACAGGG - Intronic
924968557 2:101200-101222 CCCTGGCAGGCCCGGGGGTGCGG + Intergenic
924985058 2:263586-263608 CCGCGGCAGGCGCGGGGAGGAGG - Intronic
927998842 2:27506060-27506082 CCCAGGCAGGCTCAGGGATTAGG - Intronic
928202476 2:29257140-29257162 CCCAGGGAGGATCTGGGATGGGG + Intronic
928450684 2:31375541-31375563 CTCTGGCAGGCTCTGGAAGGAGG - Exonic
929111374 2:38407787-38407809 CACTGGGAGGCGCTGGGATCTGG + Intergenic
931223277 2:60307439-60307461 AACTGGCAAGGGCTGGGATGGGG + Intergenic
932423587 2:71615293-71615315 CACTGGTGGGAGCTGGGATGGGG + Intronic
932580290 2:72988961-72988983 CCCAGGCAGGGGCTGGGGTGGGG - Intronic
934655303 2:96114251-96114273 CCCTGGCAGGCGCTGGGATGGGG - Exonic
934813547 2:97304958-97304980 CCCTGGCTTGTGCTGTGATGTGG - Intergenic
934824149 2:97403522-97403544 CCCTGGCTTGTGCTGTGATGTGG + Intergenic
935301433 2:101697285-101697307 CCCGGGGAGGAGCTGGGGTGGGG - Intronic
936011312 2:108927012-108927034 CCCTGAGAGGGGCTGGGATTCGG + Intronic
936970705 2:118173785-118173807 CCATGGCAGGCACTGGAAAGGGG + Intergenic
937052246 2:118901992-118902014 CCCTGGGAGGGGCAGGGATGAGG - Intergenic
938088270 2:128416114-128416136 CCCTGGGATTGGCTGGGATGAGG - Intergenic
938482581 2:131673769-131673791 ACAGTGCAGGCGCTGGGATGGGG + Intergenic
941325556 2:164109674-164109696 CCCTGGCAGGGTGTGCGATGGGG - Intergenic
941916503 2:170817136-170817158 GGGTGGCCGGCGCTGGGATGGGG - Intronic
942053633 2:172163021-172163043 CCCTGGGAGCCACTGCGATGGGG - Intergenic
944599542 2:201289597-201289619 CCCTGGATGGCTCTGGGTTGGGG - Intronic
945175588 2:207040403-207040425 CCTTGGTAGAGGCTGGGATGGGG + Intergenic
945791112 2:214306861-214306883 CCCTGACAGGCTTTGGGATCAGG + Intronic
946578603 2:221103217-221103239 CCGTGGCAAGTGCTGCGATGGGG + Intergenic
947042278 2:225936899-225936921 ACCTGCAAGGGGCTGGGATGGGG - Intergenic
948088157 2:235267687-235267709 CCCTGGCCTGGGCTGGGAGGAGG - Intergenic
948223805 2:236293409-236293431 CCGTGGTAGGCCCTGGAATGTGG + Intergenic
948462967 2:238139088-238139110 CCTGGGCAGGCACTGGGGTGAGG + Intronic
948725765 2:239933046-239933068 CCGTGGCAGGGCCTGGGATGGGG + Intronic
948827114 2:240578179-240578201 ACCTGGCAGGTGCTGGCATCCGG - Exonic
948889313 2:240899200-240899222 TCCTGGCACGCGGTGGTATGGGG - Intergenic
949047044 2:241877019-241877041 GCCTGGCAGGCGATGGGAGAAGG - Intergenic
1170703740 20:18727075-18727097 CCTTGGCAGGTGCTGTGGTGAGG + Intronic
1170907734 20:20530860-20530882 CTCTGCCAGGCGCTGTGCTGAGG - Intronic
1171882022 20:30624656-30624678 CCCTGACAGGCCCTGGTGTGTGG - Intergenic
1172272198 20:33660957-33660979 CCCTGAGAGGGGCTGGGAGGAGG - Intronic
1172654012 20:36525873-36525895 CCCTGCCAGGTCCTGGGCTGTGG - Exonic
1172875345 20:38160743-38160765 CCCAGCCAGGCACTGGGATCAGG - Intronic
1172880374 20:38195807-38195829 CCCTGGCAGTCGTTGGGTAGTGG + Intergenic
1172949427 20:38713209-38713231 TCTTGGCAGGGGCTGGAATGAGG + Intergenic
1173100177 20:40080223-40080245 CACTGGAATGAGCTGGGATGGGG + Intergenic
1174069077 20:47887428-47887450 CCCTGGCAAGGCCTGTGATGTGG + Intergenic
1174075434 20:47932203-47932225 GCCTGGCAGAGGCTGGGAGGTGG + Intergenic
1174379439 20:50147152-50147174 GCCTGTCATGCGCTGGGGTGTGG + Intronic
1174403252 20:50287643-50287665 CCCAGGGAGGCGCTGGGAGGGGG - Intergenic
1174507828 20:51028164-51028186 GCAGGGCAGGAGCTGGGATGAGG - Intergenic
1175284335 20:57827827-57827849 CCCTGACAGGCTGGGGGATGGGG + Intergenic
1175688191 20:61046413-61046435 CCCAGGCAGGGGCTGGGATCAGG + Intergenic
1175925559 20:62469630-62469652 CCCTGGCACTCGCAGGGGTGCGG - Intronic
1175946993 20:62563576-62563598 GCCTGGCAGAGGCTGGGGTGGGG + Intronic
1175989179 20:62779033-62779055 TCCTGGCTGGGGCTGGGATGCGG - Intergenic
1176071750 20:63230545-63230567 CCCTTGCAGGGCCTGCGATGGGG + Intergenic
1176164932 20:63667907-63667929 GCCGGGCACGCGCTGGGAAGAGG - Intronic
1176178972 20:63740841-63740863 GCCTGGCAGGGGTTGGGAGGTGG - Intronic
1176286631 21:5022281-5022303 CCCTGGGAAGCGCAGGGGTGGGG - Intergenic
1176302847 21:5106999-5107021 CCCTGGCTGGTGCTGCGGTGGGG - Intergenic
1178953900 21:37006633-37006655 CGCGGGCAAGCGCTGGGAGGGGG - Exonic
1179381525 21:40903534-40903556 CACTGGGAGGAGCTGGCATGGGG - Intergenic
1179507472 21:41851485-41851507 CCCTGGCAGGGTCAGGGAGGAGG + Intronic
1179553903 21:42160412-42160434 CCGTGGCAGGGGCTGGGTAGGGG + Intergenic
1179854177 21:44154924-44154946 CCCTGGCTGGTGCTGCGGTGGGG + Intergenic
1179862932 21:44200453-44200475 CCCTTGTTGGTGCTGGGATGTGG + Intergenic
1179870550 21:44241194-44241216 CCCTGGGAAGCGCAGGGGTGGGG + Intergenic
1179896369 21:44365829-44365851 CCCTGGGAGGAGCAGGGCTGTGG - Intronic
1179908804 21:44437420-44437442 CCCAGGCATGGGCTGGGCTGCGG + Intronic
1180046255 21:45307126-45307148 CCCAGGCAGGGGCTGGGCTCGGG + Intergenic
1180145984 21:45919086-45919108 CACTGGCAGGCACTGGGGAGAGG + Intronic
1180163111 21:46006813-46006835 GCCTGGCAGGGGCTGGGAGGAGG + Intergenic
1180261706 21:46674787-46674809 CCCTGGCAGGCCCAGGGGTGCGG - Intergenic
1180899248 22:19358900-19358922 ATCTGGCATGGGCTGGGATGGGG + Intronic
1181121305 22:20669885-20669907 CCCAGGCAAGCGCAGGGCTGGGG + Intergenic
1181334261 22:22116910-22116932 CCCAGGCAAGCGCAGGGCTGGGG + Intergenic
1181769470 22:25114860-25114882 CCGTGGCTGGGGCTGGGAGGGGG + Intronic
1182423466 22:30259761-30259783 CCCTGGAAGGCGATGGGGAGAGG + Intergenic
1182433076 22:30312125-30312147 GCCTGGTAGGAGCTGGGATTTGG - Intronic
1183047171 22:35229426-35229448 CCCTAGCAGATGCTGGGATGTGG - Intergenic
1183072099 22:35403344-35403366 CCCTGGGAAGCTCAGGGATGGGG - Intronic
1183081513 22:35459524-35459546 CCCTCGCAGGCGGTGCGGTGAGG - Intergenic
1183149576 22:36027802-36027824 CCTGGGCACACGCTGGGATGGGG - Intronic
1183377556 22:37473958-37473980 ACCTGCCAGGTGGTGGGATGGGG + Intronic
1183508230 22:38220953-38220975 CCCGGGCAGGAGTGGGGATGTGG - Exonic
1184066323 22:42123815-42123837 CCCTGGAAGGCCCAGGGCTGGGG + Intergenic
1184068791 22:42135967-42135989 CCCTGGAAGGCCCAGGGCTGGGG + Intergenic
1184118262 22:42434398-42434420 CCCAGGCAGGCCCTGGGCTGTGG + Intergenic
1184130662 22:42514832-42514854 GCCTGGCAGGCCCTGGGGTGGGG - Intronic
1184140841 22:42576662-42576684 GCCTGGCAGGCCCTGGGGTGGGG - Intergenic
1184534293 22:45076243-45076265 GCCTGTCAGGGCCTGGGATGGGG + Intergenic
1184657024 22:45947020-45947042 CCCTGGCATGGGCTGGGAGCTGG - Intronic
1184720339 22:46308951-46308973 CCCAGGCAGGCGCTCTGCTGTGG - Intronic
1184918572 22:47590030-47590052 CCCTGGCAGGTGGTGGTATAAGG - Intergenic
1184973527 22:48044866-48044888 TCCTGCCAAGCCCTGGGATGAGG - Intergenic
1184986760 22:48141121-48141143 CACTGGCAGGGCCTGGAATGAGG + Intergenic
1184988516 22:48152587-48152609 CCCTGGCAGGCTCTGGTACATGG - Intergenic
1185150911 22:49163602-49163624 CCTTGGCGGGTGCTAGGATGGGG - Intergenic
1185419558 22:50727960-50727982 GGCTGGCAGGTGCTGTGATGTGG + Intergenic
950525304 3:13519549-13519571 CCCCGTCAGGAGGTGGGATGAGG + Intergenic
950556431 3:13698867-13698889 CCCAGGCAGCGGCTGGCATGGGG - Intergenic
950570542 3:13797104-13797126 CCCAGGCAGGCTCTGGGAGAGGG + Intergenic
950607578 3:14096416-14096438 CCCTGGAAGTCGCAGGGATTGGG - Intergenic
950703939 3:14768551-14768573 ACCTGGCAGGGACTGGGTTGGGG + Intronic
950709924 3:14806808-14806830 CCCAGACAGGCAGTGGGATGTGG - Intergenic
951946130 3:28138448-28138470 CCCTGGCAGGCTTGGGGAGGGGG + Intergenic
953547379 3:43873370-43873392 GCCTTGCAGGTGATGGGATGGGG - Intergenic
954410279 3:50367599-50367621 CCCTGGCAGGGGCAGGGTTTGGG + Intronic
955071282 3:55574511-55574533 CCTTGGGAAGAGCTGGGATGGGG + Intronic
956100409 3:65762149-65762171 TCCTGGCAGGCGCTGGGTGCTGG - Intronic
956928065 3:74010672-74010694 CCCTGGTAGGGGGTGGGAGGTGG + Intergenic
961438062 3:126932883-126932905 CCCTGGCTGCCGCTGGGCTGAGG + Intronic
962121472 3:132565186-132565208 CCCTGGCAAGCACTGTAATGAGG + Intronic
962204334 3:133422751-133422773 TTCTGGCAGGTGCTGGGCTGGGG - Intronic
962736438 3:138329603-138329625 CCCTGGCCGGCTCCGGGGTGGGG - Intronic
962837685 3:139203599-139203621 CCCTGGTAGGCCTTGGGGTGGGG + Intronic
963804964 3:149714026-149714048 CTCTGGCAGCCGCCGTGATGGGG + Intronic
965310106 3:167116483-167116505 CCCTGGGAGCCGCTGCCATGGGG - Intergenic
965433084 3:168612945-168612967 CCCTGGCAGGGCGTGCGATGGGG - Intergenic
965548261 3:169937407-169937429 GCCTGTCAGGGGTTGGGATGGGG - Intronic
967697363 3:192547760-192547782 CCCTGGCCAGTGCTGTGATGAGG - Intronic
967753328 3:193140300-193140322 CCCCGGGAGGGGCTGAGATGAGG - Intergenic
967891435 3:194366964-194366986 GCCTGGCAGGGCCTGGGATTGGG + Intronic
968084690 3:195869053-195869075 CCGTGACAGGGGCGGGGATGAGG - Intronic
968443146 4:634532-634554 CCCTGCTGGGCACTGGGATGTGG - Intronic
968517251 4:1020599-1020621 CCCAGGCAGGGGATGGGGTGGGG + Intronic
968517276 4:1020652-1020674 CCCAGGCAGGGGATGGGGTGGGG + Intronic
968517320 4:1020742-1020764 CCCAGGCAGGGGATGGGGTGGGG + Intronic
968517383 4:1020864-1020886 CCCAGGCAGGGGATGGGGTGGGG + Intronic
968517542 4:1021184-1021206 CCCAGGCAGGGGATGGGGTGGGG + Intronic
968966002 4:3769416-3769438 GCCTGGCAGGAGCTGGGCAGGGG + Intergenic
968975560 4:3820533-3820555 CCCGGGCTGGGGCTGGGGTGGGG + Intergenic
969244091 4:5921336-5921358 CCCAGTCAGGCGGTGGGCTGGGG + Intronic
969721375 4:8894466-8894488 CCCTGCCAGGCGCTGCCATGGGG + Intergenic
969722320 4:8899165-8899187 CCCTGGCAGGGACTCGGGTGCGG + Intergenic
970503436 4:16702599-16702621 CCCTTGCAGACCCTGTGATGTGG + Intronic
971452604 4:26813938-26813960 GCTTGGCAGGAGCTGGCATGAGG - Intergenic
972940270 4:44186699-44186721 CCCTGGCAGGGCATGTGATGCGG - Intronic
977557393 4:98499225-98499247 CCCGGGCAGGCGGTGGGCAGAGG + Intronic
979189179 4:117835292-117835314 CCCTTGCAGGTCCTGCGATGAGG + Intergenic
979515881 4:121609544-121609566 CCCTGGAAGCACCTGGGATGAGG - Intergenic
983208309 4:164933362-164933384 CCATGAGAGGCGCTGGGGTGAGG + Intergenic
984502170 4:180570477-180570499 CCCTGCCAGGGGCTGGGCGGTGG + Intergenic
984708289 4:182863718-182863740 CTCAGGCTGGCGCTGGGGTGTGG - Intergenic
984754442 4:183312829-183312851 CCTTGTCAGGCTCTGAGATGTGG + Intronic
985262543 4:188128382-188128404 CCCTGGCAGTGGATGGGCTGAGG - Intergenic
985590080 5:759974-759996 CGCTGGCCGGCGCTGGGCTCAGG - Intronic
985625086 5:981691-981713 CCCTGGCTGGCCCTGGGAGAAGG - Intergenic
986721732 5:10564894-10564916 AGCTGGGAGGCGCGGGGATGTGG - Intronic
992202281 5:74396204-74396226 CACTGGCAGGGGCTGGGACAGGG - Intergenic
995349298 5:111156649-111156671 CCCTAGCAGGGGCTGGTATTGGG - Intergenic
996648085 5:125841174-125841196 CCCTGACTGGGGCTGGAATGTGG - Intergenic
997378878 5:133421115-133421137 CCCTGGCAGGGGCCTGGGTGTGG + Intronic
997528954 5:134570573-134570595 AGGTGGCAGGCTCTGGGATGTGG - Intronic
998140003 5:139694356-139694378 GCCTGGCCGGGGCTGGGTTGAGG + Intergenic
998252357 5:140561700-140561722 CCCTAGCAGGGGCAGAGATGGGG + Exonic
998558539 5:143149381-143149403 CCATGGCAGACGCTGGTATCAGG - Intronic
999109696 5:149108037-149108059 CCATGGCAGGCCCTGGTGTGTGG - Intergenic
999117894 5:149180450-149180472 CCAGGGCAGGAGCAGGGATGTGG + Intronic
1002028980 5:176414391-176414413 CCCTGGCAGGAGATAGGATGTGG - Intronic
1002189441 5:177471131-177471153 CCCTGGGGTGAGCTGGGATGGGG + Intronic
1002442225 5:179270439-179270461 CCCTGGCAGAAGCTGGCAGGAGG - Intronic
1002475289 5:179461758-179461780 CCATGCCAGGTGCTGGGATGTGG - Intergenic
1002596526 5:180327458-180327480 CCCAGGCAGGCAGTGGGAAGAGG - Intronic
1002675531 5:180909197-180909219 CCCAGGCAGGGGCTGAGAAGGGG - Intronic
1003161050 6:3634677-3634699 CGTTGCCAGGGGCTGGGATGAGG + Intergenic
1004126931 6:12883133-12883155 CTCAGGCAGGGGCTGGGGTGGGG - Intronic
1004504794 6:16238916-16238938 TCCTGGCAGGTGCTGGGGCGCGG - Intronic
1006508967 6:34511549-34511571 CCCTGGCAGGCACCCGGAGGAGG - Intronic
1007301610 6:40871939-40871961 CCCTGTGGGGTGCTGGGATGGGG + Intergenic
1007373448 6:41441782-41441804 CCCTGTCAGGTGAGGGGATGTGG - Intergenic
1007380931 6:41489688-41489710 CCCTGCCTGGGGCTGGGCTGGGG - Intergenic
1007470741 6:42088644-42088666 CCCTGGCAGGGCATGGGCTGAGG - Intergenic
1008967089 6:57323605-57323627 CCCTGACAGGCCCTGGTGTGGGG - Intronic
1009668599 6:66715481-66715503 CCTTAGCAGGAGCTTGGATGGGG + Intergenic
1010053583 6:71537180-71537202 ACCTGTCAGGCGGTGGCATGGGG - Intergenic
1010281574 6:74029294-74029316 CCCTGCCAGGCTTTGGTATGAGG + Intergenic
1013362140 6:109403909-109403931 CCCAGGCAGGTGAAGGGATGAGG + Intronic
1014225374 6:118840979-118841001 CCAAGGCAGGGGCAGGGATGGGG - Intronic
1016429060 6:143964089-143964111 CCTTATCAGGCCCTGGGATGGGG - Intronic
1016714018 6:147203813-147203835 CCCTGTCAGGCGATGGGGAGCGG + Intergenic
1016949568 6:149566613-149566635 CCCTGCCCGCCGGTGGGATGTGG - Intronic
1017154761 6:151312859-151312881 CCATGGCAGGAGATGGGGTGAGG + Intronic
1017232998 6:152092682-152092704 CCCTGCAAGGCGCTGTGATTAGG + Intronic
1017339246 6:153301766-153301788 CCCTGGCAGGGCGTGCGATGGGG + Intergenic
1018420449 6:163636179-163636201 CTCTGGGAGGCTCTGGGCTGGGG + Intergenic
1018804429 6:167248041-167248063 GCCTGGCAGGAGCCAGGATGTGG + Intergenic
1018827606 6:167421484-167421506 CCTTGGCTGGCGCTGGGCCGGGG + Intergenic
1018991268 6:168676022-168676044 CAATGGCAGGTGCTGGGAAGGGG - Intergenic
1019138417 6:169927152-169927174 CCCTGGCAGGGGCCGGGCTGAGG + Intergenic
1019271902 7:154191-154213 CCCTGGCAGGGACTGGCAGGAGG - Intergenic
1019365554 7:630778-630800 CCCAGTCAGGTGCAGGGATGGGG + Intronic
1019430526 7:996925-996947 GCCTGGCGTGCGCTGGCATGGGG + Intergenic
1019712778 7:2525026-2525048 CCCTGGAAGGGGCTGGGCTGCGG + Intronic
1020029239 7:4921156-4921178 CCCAGAGAGGGGCTGGGATGTGG - Intronic
1020545484 7:9523977-9523999 GCCTGTCAGGGGGTGGGATGGGG - Intergenic
1022042818 7:26596508-26596530 CCCAGGCAAGCTCTGGGAGGCGG + Intergenic
1023090875 7:36616163-36616185 TCCTGGCAGCAGCTGGGCTGAGG + Intronic
1023684654 7:42721884-42721906 GCCTGGCCGGGGCTGGGCTGGGG - Intergenic
1023873640 7:44275755-44275777 CCCTGGGAGGGGCAGGCATGCGG + Intronic
1024406660 7:48989936-48989958 AACTGGCAGGGGTTGGGATGGGG + Intergenic
1024469471 7:49752327-49752349 CCCTGGCATGAGCTGTGAAGTGG - Intergenic
1025021400 7:55483249-55483271 CTCTGGGTGGCGCTGGGGTGAGG + Intronic
1025230243 7:57199144-57199166 CCCTTTAAGGCGCTGGGAAGAGG - Intergenic
1026087179 7:67271918-67271940 CCCTGACAGGCCCTGGTGTGTGG - Intergenic
1026689919 7:72542781-72542803 CCCTGACAGGCCCTGGTGTGTGG + Intergenic
1026945527 7:74313662-74313684 CCCTGGCAGGCTCTCCCATGCGG + Intronic
1027233600 7:76285547-76285569 CCCTGGCCGCTGCTGGGATGGGG + Intronic
1029465239 7:100720964-100720986 CCCGGCCAGGCGCGGAGATGGGG + Exonic
1029664581 7:101986925-101986947 CCCTGGAAGCCGTGGGGATGTGG + Intronic
1029716302 7:102328996-102329018 CCCTGGTGGGGGCTGGGAGGTGG - Intergenic
1029722937 7:102382202-102382224 CCCTGGTGGGGGCTGGGAGGTGG - Intronic
1029730330 7:102434222-102434244 CCCAGGCAGGGGGTGGGGTGGGG - Intronic
1030115411 7:106058942-106058964 CCCTGGCAGATCCTGGCATGTGG + Intergenic
1032162394 7:129520837-129520859 ATCTGGCAGGTGCTGGGCTGAGG + Intergenic
1032525703 7:132577090-132577112 CCCGGGGAGGCGCGGGGCTGCGG + Exonic
1032533028 7:132637555-132637577 CTTAGGCAGGAGCTGGGATGAGG - Intronic
1033657160 7:143381806-143381828 CCCCGGCAGGAGCCGGGGTGGGG + Intronic
1033942264 7:146670349-146670371 CCATGGCATACGCTGGAATGAGG - Intronic
1034437428 7:151069878-151069900 CAGTGGCAGGAGATGGGATGGGG - Intronic
1034848815 7:154474445-154474467 CCCTGGCTGTCTCTGGGTTGTGG - Intronic
1035349778 7:158237926-158237948 CCATGGCAGCCGCCGGGCTGCGG - Intronic
1036364815 8:8111027-8111049 CCATGGAAGGAGCTGGGAGGGGG + Intergenic
1037562317 8:20086061-20086083 CACTGGGAGGGTCTGGGATGGGG + Intergenic
1038789859 8:30658467-30658489 CTCCGGCGTGCGCTGGGATGTGG + Intergenic
1039469402 8:37803928-37803950 CCCTGGCAGGGGAAGGGAGGAGG - Intronic
1039595726 8:38788186-38788208 CCCTGGCAGCTGCTGGGAAATGG + Intronic
1039955253 8:42202475-42202497 GTCTGGTAGGCGCTGGGAGGAGG - Intronic
1040286235 8:46101835-46101857 CCCTGGGAGATTCTGGGATGGGG + Intergenic
1041205644 8:55495544-55495566 CCCTGGAAGCCACTGTGATGGGG - Intronic
1041231515 8:55757557-55757579 ACCTGTCAGGCGCTGGGAAAGGG + Intronic
1047235868 8:123041799-123041821 CCCGGGGAGGCTCTGGGATCTGG - Intronic
1049093688 8:140535300-140535322 CTGTGCCAGGCGCTGGGGTGGGG - Intronic
1049229053 8:141472737-141472759 CCCTGGGAGGATCTGGGAGGAGG + Intergenic
1049358015 8:142198321-142198343 CCCTAGCAGCTGCTGGGCTGGGG + Intergenic
1049361580 8:142214618-142214640 CCGTAGCAGGGGCTGGAATGAGG - Intronic
1049414974 8:142490996-142491018 CCCTGGGAGGGGGTGGGAGGCGG - Intronic
1049446685 8:142634564-142634586 CCCTGGCAGGGGCTGGGGTGGGG - Intergenic
1049587264 8:143437823-143437845 CCCTGGAAGGTGGTGGGGTGGGG + Exonic
1049659005 8:143811432-143811454 CCCTGGCTGGAGCTGGCCTGGGG - Intronic
1049743283 8:144251076-144251098 CCCTGGCAGGCGGGGGCATGAGG + Intronic
1049792720 8:144479348-144479370 CCCGGGCTGGGGTTGGGATGGGG + Intronic
1051348300 9:16172369-16172391 TCCTGGCAGACTCTGGCATGGGG - Intergenic
1051776700 9:20642132-20642154 CCCTGTCAGTTGCTGGTATGGGG - Intergenic
1055737828 9:79351381-79351403 GCCTGTCAGGGGTTGGGATGTGG - Intergenic
1056383176 9:86074131-86074153 CCATGGGAGGAGCTGGGGTGTGG - Intronic
1056521494 9:87405993-87406015 CACTGCCAGGGGCTGGGGTGGGG - Intergenic
1057278887 9:93696593-93696615 CCAGGGCAGGGGATGGGATGGGG + Intergenic
1057572744 9:96216776-96216798 CCCTGGCAGAGGCAGGGGTGGGG + Intergenic
1060561513 9:124548903-124548925 CCATGGCAGGAAGTGGGATGGGG - Intronic
1060724819 9:125999725-125999747 CTCTGGCAAGCACTGGGATTGGG + Intergenic
1060812035 9:126615394-126615416 CCCTCGCAGACGGCGGGATGCGG - Exonic
1060934789 9:127508629-127508651 CCCTGGCAGGCCTCGGGGTGGGG - Intronic
1061434992 9:130555498-130555520 CCCTGCCAGCAGCTGGGGTGGGG - Intergenic
1061925993 9:133806314-133806336 CCCTGGCATGCACAGAGATGTGG - Intronic
1062164764 9:135102084-135102106 CCCTGTCAGCCGCTGGGAGCTGG + Intronic
1062250171 9:135589924-135589946 CTCTGGGAGCTGCTGGGATGGGG - Intergenic
1062309642 9:135928989-135929011 CCCAGGCAGCCCCTGGGCTGTGG - Intergenic
1062379339 9:136279659-136279681 CCCGGGTATGGGCTGGGATGGGG - Intergenic
1062547200 9:137069165-137069187 CCAAGGCAGGCACTGGGTTGGGG + Intronic
1062637307 9:137498367-137498389 CACTGGCAGGGGCTGGGACGGGG + Intronic
1185647228 X:1624411-1624433 CCCAGGCAGATGCTGGGAGGTGG + Intronic
1185647236 X:1624442-1624464 CCCAGGCAGATGCTGGGAGGTGG + Intronic
1185647248 X:1624473-1624495 CCCAGGCAGATGCTGGGAGGTGG + Intronic
1185647257 X:1624504-1624526 CCCAGGCAGATGCTGGGAGGTGG + Intronic
1185647268 X:1624535-1624557 CCCAGGCAGATGCTGGGAGGTGG + Intronic
1185647278 X:1624566-1624588 CCCAGGCAGATGCTGGGAGGTGG + Intronic
1185647290 X:1624597-1624619 CCCAGGCAGATGCTGGGAGGTGG + Intronic
1185647298 X:1624628-1624650 CCCAGGCAGATGCTGGGAGGTGG + Intronic
1185647310 X:1624659-1624681 CCCAGGCAGATGCTGGGAGGTGG + Intronic
1185647328 X:1624721-1624743 CCCAGGCAGATGCTGGGAGGTGG + Intronic
1185647346 X:1624783-1624805 CCCAGGCAGATGCTGGGAGGTGG + Intronic
1185647356 X:1624814-1624836 CCCAGGCAGATGCTGGGAGGTGG + Intronic
1185647366 X:1624845-1624867 CCCAGGCAGATGCTGGGAGGTGG + Intronic
1185647376 X:1624876-1624898 CCCAGGCAGATGCTGGGAGGTGG + Intronic
1185647387 X:1624907-1624929 CCCAGGCAGATGCTGGGAGGTGG + Intronic
1185647395 X:1624938-1624960 CCCAGGCAGATGCTGGGAGGTGG + Intronic
1185647406 X:1624969-1624991 CCCAGGCAGATGCTGGGAGGTGG + Intronic
1186439107 X:9569976-9569998 TCCTGGCATGGGGTGGGATGGGG + Intronic
1187362559 X:18641975-18641997 CCCTGGCAGGCGCCGAGCTGAGG + Exonic
1187365244 X:18661271-18661293 CCCTTGCATGCCCTGAGATGGGG - Intronic
1189552372 X:42106491-42106513 CCCTGGCAGGAGATTGGAAGTGG - Intergenic
1189585367 X:42455727-42455749 CTATGGCAGCCGGTGGGATGGGG - Intergenic
1192246882 X:69380077-69380099 CCCAGGCAGGGGCTGGCAAGAGG + Intergenic
1197726784 X:129781802-129781824 CTCTGGCAGGGGTTGGGGTGGGG - Intronic
1198508192 X:137322437-137322459 GGCTGCCAGACGCTGGGATGGGG + Intergenic
1200090684 X:153634479-153634501 CCCGGCCTGGCTCTGGGATGGGG - Intergenic
1200161913 X:154013949-154013971 ACCTAGCAGGTGCTGAGATGGGG + Intronic