ID: 934655449

View in Genome Browser
Species Human (GRCh38)
Location 2:96114829-96114851
Sequence GGATCCTCCGGAAGGCACGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934655441_934655449 6 Left 934655441 2:96114800-96114822 CCAGGCCGTCTGGGTCCACGGGC 0: 1
1: 0
2: 0
3: 12
4: 166
Right 934655449 2:96114829-96114851 GGATCCTCCGGAAGGCACGGCGG 0: 1
1: 0
2: 0
3: 10
4: 102
934655445_934655449 -9 Left 934655445 2:96114815-96114837 CCACGGGCGGCACAGGATCCTCC 0: 1
1: 0
2: 0
3: 11
4: 119
Right 934655449 2:96114829-96114851 GGATCCTCCGGAAGGCACGGCGG 0: 1
1: 0
2: 0
3: 10
4: 102
934655443_934655449 1 Left 934655443 2:96114805-96114827 CCGTCTGGGTCCACGGGCGGCAC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 934655449 2:96114829-96114851 GGATCCTCCGGAAGGCACGGCGG 0: 1
1: 0
2: 0
3: 10
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934655449 Original CRISPR GGATCCTCCGGAAGGCACGG CGG Exonic