ID: 934655709

View in Genome Browser
Species Human (GRCh38)
Location 2:96116069-96116091
Sequence GATGGTAAAGAGAATGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 787
Summary {0: 1, 1: 1, 2: 7, 3: 65, 4: 713}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934655706_934655709 -7 Left 934655706 2:96116053-96116075 CCAGAGCGTTGCCGAAGATGGTA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 934655709 2:96116069-96116091 GATGGTAAAGAGAATGAGGAAGG 0: 1
1: 1
2: 7
3: 65
4: 713
934655704_934655709 2 Left 934655704 2:96116044-96116066 CCAGGATGACCAGAGCGTTGCCG 0: 1
1: 0
2: 0
3: 1
4: 43
Right 934655709 2:96116069-96116091 GATGGTAAAGAGAATGAGGAAGG 0: 1
1: 1
2: 7
3: 65
4: 713

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934655709 Original CRISPR GATGGTAAAGAGAATGAGGA AGG Exonic
901376574 1:8843852-8843874 AATTGGAAAGAGAATGGGGAAGG - Intergenic
901535771 1:9882199-9882221 GCTGGTAGAGAGAAAGGGGAAGG + Intronic
901963569 1:12847451-12847473 GATGAAAAAGAGGCTGAGGAAGG - Exonic
903029084 1:20449802-20449824 GATGGTAACAAGGATGTGGAGGG + Intergenic
903912071 1:26734920-26734942 GAAGGTAACGTGAATGAGTAAGG - Intronic
904224890 1:29008492-29008514 AATGGTAGAGAGGATGAGGCAGG + Intronic
904401764 1:30261388-30261410 GATGGTAATGACTATGAGGATGG + Intergenic
904413349 1:30338956-30338978 GATGGTAATGATGATGATGATGG + Intergenic
904424995 1:30417374-30417396 GTGGGTCAACAGAATGAGGAAGG + Intergenic
904434934 1:30488471-30488493 AATGGTAATGAGAGTGATGATGG + Intergenic
904439252 1:30519187-30519209 GATGGGAAAGATGATGATGATGG + Intergenic
904439255 1:30519205-30519227 GATGGAAAAGATGAGGAGGATGG + Intergenic
904439270 1:30519346-30519368 GATGATAAAGAGGATGATGATGG + Intergenic
905083829 1:35351096-35351118 GGTGGTAAATACAATGTGGAAGG + Intronic
905269752 1:36779826-36779848 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
906419234 1:45649856-45649878 GATGGGAAAGAAAATCAGAATGG - Intronic
906650615 1:47509925-47509947 GACGGTAAAGAGAAGTAGCAAGG + Intergenic
906844427 1:49176149-49176171 GATGGTGATGACAATGATGATGG + Intronic
907233883 1:53026834-53026856 GAAGGAAAAGGGAAAGAGGAAGG + Intronic
907470938 1:54673081-54673103 GATGGTAAAGAGCCTGTGGATGG - Exonic
907951387 1:59187183-59187205 TATGGAATAGAGAATGAGCAAGG + Intergenic
908378092 1:63566346-63566368 GAGGGTGAAGAGTACGAGGAGGG + Intronic
908415002 1:63904562-63904584 GAATTTAAAGAGAAGGAGGAAGG - Intronic
909652273 1:77988816-77988838 GAATGTACAGAGAATGAGGCAGG + Intronic
910108964 1:83661581-83661603 GAGGGCAGAGAGAGTGAGGACGG - Intergenic
910347203 1:86253659-86253681 GATGGAAAAGAAAATGACGCAGG - Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
911050410 1:93666062-93666084 GATGGAGAAGAGGATGAGGAGGG - Intronic
911437053 1:97874094-97874116 GATGATGAAGACAATGAGGATGG - Intronic
911628005 1:100148262-100148284 GATAGTGAAGAGCATGATGATGG + Exonic
912957154 1:114163329-114163351 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
912963072 1:114213325-114213347 GATAGGAAAGAAAATGAAGATGG + Intergenic
912965129 1:114230611-114230633 GATAGGAAAGGGCATGAGGAGGG - Intergenic
914886384 1:151587909-151587931 AATGGTAAAGAAAATTTGGAAGG + Intergenic
915555166 1:156657237-156657259 GAAGGGAGAGAGAATGAGAAGGG - Intronic
916014230 1:160734348-160734370 CTTGGCAAACAGAATGAGGATGG - Intergenic
916608271 1:166364125-166364147 GAGGCCAAAAAGAATGAGGAGGG - Intergenic
916971175 1:170018194-170018216 GCTGGTAAAAAAAATGAGCATGG - Intronic
916982379 1:170152730-170152752 GATGAAAAATATAATGAGGAGGG + Intronic
917194976 1:172455501-172455523 GATGTCAATGTGAATGAGGAAGG + Intronic
917236713 1:172900565-172900587 GGTGGTAAAGAGAAGGAAGTTGG - Intergenic
917619138 1:176777829-176777851 GATGGTAATGATAATGATGATGG - Intronic
917695902 1:177523746-177523768 GATGGGAAAGACAAAGAGTAAGG + Intergenic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
918543656 1:185658612-185658634 CATGGTAGACAGAATGAGGGTGG - Intergenic
918703803 1:187637261-187637283 GATAGTAATGCAAATGAGGATGG - Intergenic
919178097 1:194045509-194045531 GGAGGTAAAGAGAATGTGAAGGG - Intergenic
919867441 1:201793038-201793060 CAAGGTAAAGGGAATGAGGCCGG - Intronic
920199804 1:204252554-204252576 GAAGGGAAAGTGAATGAGAAAGG + Intronic
920603576 1:207355358-207355380 GAGGAAAGAGAGAATGAGGATGG + Intronic
920778984 1:208969608-208969630 GATAGCAAAGAGAAGGGGGAGGG + Intergenic
920928146 1:210362354-210362376 CATGGTCAGGAGAATGAGGCAGG - Intronic
921298448 1:213726633-213726655 GATGGAAAAGATGATGAGAAAGG - Intergenic
921637623 1:217514489-217514511 GTTGGGATAGAGAATAAGGATGG + Intronic
921991126 1:221369072-221369094 GAAGGTGAAGAGAAAGAGAATGG - Intergenic
922082161 1:222308040-222308062 GATGGTGAGGAGGAGGAGGAAGG - Intergenic
922894342 1:229088771-229088793 CAAGGTAAGGAGAAAGAGGAGGG + Intergenic
923851214 1:237797327-237797349 GATGCTAATTAAAATGAGGATGG + Intronic
924700018 1:246441907-246441929 GATAGTAAAGAGAAAGAAGGTGG - Intronic
924819280 1:247472827-247472849 AGTGGTGAAGAGAATGAGGTTGG - Intergenic
1063012437 10:2037488-2037510 GATGGTGATGAGGATGATGAGGG + Intergenic
1063227870 10:4033374-4033396 GATGCTGAAGAGAAGGAGGTGGG - Intergenic
1063373260 10:5535690-5535712 GAAAGAAAAGAGAATGTGGAAGG - Intergenic
1063649252 10:7917229-7917251 GAGGGAAAAGAGAGCGAGGATGG + Intronic
1063701257 10:8387389-8387411 GAAGGTAATTAGAATGAGAAGGG + Intergenic
1063764308 10:9120535-9120557 GATGATACAGAGTATGAGGGTGG - Intergenic
1065204539 10:23344304-23344326 GATGGAAAGGAGGATGGGGAGGG + Intronic
1065638317 10:27753311-27753333 GAGGGAAAAGAGAGAGAGGAAGG - Intergenic
1066526726 10:36288241-36288263 GATGGGAATGAGAATCAGGTGGG - Intergenic
1067512349 10:46906497-46906519 GAGAGCAAAGAGAAAGAGGATGG + Intergenic
1067649894 10:48145325-48145347 GAGAGCAAAGAGAAAGAGGATGG - Intergenic
1068239533 10:54288021-54288043 GATGGGAAAGAGAGAGAGAAAGG + Intronic
1068826427 10:61445194-61445216 GATGGTGATGAAAATGATGATGG - Intronic
1069344381 10:67450630-67450652 GAGGGTAGAGAGTAGGAGGAGGG + Intronic
1069344957 10:67457939-67457961 CATGGCAAAGGGAATTAGGATGG - Intronic
1069561391 10:69432972-69432994 CATGGCGAAGAGGATGAGGAAGG + Intergenic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1069852687 10:71420448-71420470 GATGGTGATGATAATGATGATGG + Intronic
1069899476 10:71699074-71699096 GATGGTAATGATAGTGATGATGG - Intronic
1070049950 10:72878841-72878863 GAAGGAGAAGAGAAAGAGGATGG + Intronic
1070139162 10:73724212-73724234 GATGGTTAAGAGACTGGGAAGGG + Intergenic
1070476810 10:76836841-76836863 GAGGGCAAAGAGGATGAGGAAGG - Intergenic
1070771860 10:79087255-79087277 GATGGTAAAGTGTTGGAGGAAGG + Intronic
1070790553 10:79186884-79186906 GATGGTTAAGAGAGTGGGCAGGG - Intronic
1070978886 10:80628540-80628562 GAGGGCAAAGTGAATGGGGAAGG + Intronic
1071431900 10:85613015-85613037 GAAGTAAAAGAGAATCAGGAAGG + Intronic
1071476594 10:86030904-86030926 GCTGGCAAAGAGAAGGAAGATGG - Intronic
1071809576 10:89164779-89164801 GATGGTAAGGAAGAAGAGGAAGG + Intergenic
1072061104 10:91811323-91811345 GATGATTAGGAAAATGAGGAGGG - Intronic
1072372900 10:94783395-94783417 GATGGAAAAGAGTAGGTGGATGG + Intronic
1072388001 10:94951844-94951866 GATGGGAAAGAGTAGGTGGATGG + Intronic
1072527607 10:96287415-96287437 AATGGTAAAGAGAGTGAGAGAGG - Intergenic
1072979581 10:100088637-100088659 GATGGGAAAGAGAATTGGAAAGG - Intergenic
1073192066 10:101658568-101658590 AATGAAAAAGAAAATGAGGAAGG + Intronic
1073547196 10:104360624-104360646 GAGGGTGAAGAGTAGGAGGAGGG - Intronic
1073920044 10:108448382-108448404 GATGGAAAAGAGGAAGAGGAGGG + Intergenic
1074297145 10:112200652-112200674 GATGGTGAAGAAGATGAAGAAGG + Intronic
1074614545 10:115054103-115054125 GAGGGCAAAGAGGAAGAGGAGGG - Intergenic
1075969107 10:126637884-126637906 GATGGAGATGAGAATGAGGAAGG + Intronic
1076066371 10:127451313-127451335 GATGCTAAAAAACATGAGGATGG - Exonic
1076556383 10:131324230-131324252 GATGATAAAGAACATGAAGAGGG + Intergenic
1076666821 10:132097930-132097952 GATGGGAAAGGGAAAGGGGAAGG - Intergenic
1077663364 11:4088487-4088509 GATGAAAATGAGAATGAGAATGG - Intronic
1077728034 11:4696384-4696406 GATGAGAGAGAGAAAGAGGAGGG - Intronic
1077898322 11:6470753-6470775 GAGGGTAAAGAGAGAAAGGAGGG + Intronic
1077978710 11:7276664-7276686 GATGCTTAAAAGAATGATGAGGG - Intronic
1078517776 11:12039327-12039349 GTTGGTAAAGGGGAGGAGGACGG + Intergenic
1079445687 11:20554479-20554501 GAAGGTAAGGAGATAGAGGAAGG - Intergenic
1079662362 11:23055033-23055055 GATGGTGAAGAGTGGGAGGAAGG - Intergenic
1079991106 11:27248175-27248197 GATGGGAGAGAGAAGAAGGAAGG + Intergenic
1080163350 11:29206314-29206336 GATTGCAATGAGAATAAGGAAGG - Intergenic
1080478364 11:32619857-32619879 GAAGGGAAGGAGAAGGAGGAGGG + Intronic
1081019158 11:37921823-37921845 GAAGGTAAACAGAAAGAGGCAGG - Intergenic
1081371346 11:42307928-42307950 GATGGTTAAGAGAATGCAAAAGG + Intergenic
1081490214 11:43562231-43562253 GATGGGAAAGAGAAAAAGGCAGG - Intronic
1081610622 11:44561066-44561088 GAAGGTAAAGAGAATGAGTGCGG - Intergenic
1082565799 11:54676771-54676793 GATGGGGAAGAGAGTGGGGAGGG - Intergenic
1082868019 11:57917602-57917624 GATGGTAAAGAGGATGAGCAAGG + Intergenic
1082873557 11:57965964-57965986 GATGGTGGAGAGTAGGAGGAGGG - Intergenic
1083067469 11:59939707-59939729 GAAGAGAAAGAGAAAGAGGAAGG - Intergenic
1083269691 11:61565596-61565618 GAAGGAAAAAAGAATAAGGAAGG + Intronic
1083806256 11:65075999-65076021 GCTGTTAAAGAGAGTGACGAGGG + Intronic
1084018770 11:66404378-66404400 GAAGGCAAAGAGAAGGTGGAGGG + Intergenic
1085610827 11:77947201-77947223 GATGGAGAAGAGAAAGAGAAAGG + Intronic
1085937236 11:81162332-81162354 GATGGCAAAGAGAAGGAGAGTGG + Intergenic
1086267674 11:85020791-85020813 GATGAAAAAGAGGCTGAGGAAGG - Intronic
1086463161 11:87025714-87025736 GATGAAAAAGAGGCTGAGGAAGG + Intergenic
1086496132 11:87406180-87406202 GATGGCAAAGGAAATAAGGAGGG + Intergenic
1086698776 11:89875516-89875538 GATGGTGATGAGAATGCAGATGG - Intronic
1086707394 11:89968983-89969005 GATGGTGATGAGAATGCAGATGG + Intronic
1087224806 11:95586643-95586665 GTTAGTATTGAGAATGAGGAAGG - Intergenic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1087836242 11:102878165-102878187 GTTGGTAAAGGGAATGAGAAGGG - Intergenic
1088108129 11:106228547-106228569 GATGGTAATGGAAATGAGGATGG - Intergenic
1088130600 11:106484634-106484656 CATGATGAGGAGAATGAGGATGG - Intergenic
1088788142 11:113201049-113201071 GATGGAAAAGGGAAGGAGGAGGG - Intronic
1088804419 11:113339033-113339055 GATGGTGTAGAAAATGAAGAAGG - Intronic
1089061034 11:115626275-115626297 GATAGTGAATAGAAAGAGGAGGG - Intergenic
1090284082 11:125483998-125484020 AATGTGAAAGAGAATGAGGATGG - Intronic
1091011467 11:132005066-132005088 GATGGTAAAGGGGCAGAGGATGG + Intronic
1091138055 11:133210600-133210622 GATGGAACAGGGGATGAGGAAGG - Intronic
1091179093 11:133587511-133587533 GATAGTAATGATAATGAGGGTGG + Intergenic
1091180838 11:133603133-133603155 GATGGTAAAGGGGATGATAATGG - Intergenic
1091668868 12:2438328-2438350 GATGGTGATGATAATGATGATGG + Intronic
1091865035 12:3826134-3826156 TATGGTAAAGAGAATAGGGGTGG - Intronic
1091937855 12:4447504-4447526 GCTGGTAAACTGAATGGGGAGGG + Intergenic
1092087281 12:5773555-5773577 GATGATAAAGATGATGATGATGG - Intronic
1092630848 12:10374673-10374695 GATATTAAAAAGAATGAGGCCGG - Intronic
1092689986 12:11097738-11097760 GATGATGAAGAGAATGATGATGG + Intronic
1092918940 12:13213702-13213724 GATGATAGAGAGAATCATGAAGG - Exonic
1092979635 12:13781187-13781209 GATGGTAGAAAGAATAATGAAGG + Intronic
1094263840 12:28531907-28531929 GATGGTAAATAGCATAAGGAAGG + Intronic
1096081693 12:48837579-48837601 AATGGAAATGAGGATGAGGAAGG - Exonic
1096184841 12:49572081-49572103 TGTGGATAAGAGAATGAGGAGGG + Intronic
1096244602 12:49977177-49977199 GTTGGTAATGAGAGGGAGGAGGG + Intronic
1096737242 12:53665317-53665339 CATGGCAAAGAGGATGAGAAAGG + Exonic
1097403079 12:59153400-59153422 GATAGGAAAGATAATCAGGAAGG - Intergenic
1097734693 12:63168651-63168673 TATGGGAAAGATAATAAGGAGGG - Intergenic
1097776507 12:63652772-63652794 GAGGGTGAAGGGTATGAGGAGGG + Intronic
1097914871 12:65010354-65010376 GTTGCTAATGAGAATGAGAAAGG + Intergenic
1098056071 12:66506824-66506846 TATGTAAAAGGGAATGAGGAAGG + Intronic
1098200692 12:68052247-68052269 GATGATAAACAGAATGAGTATGG + Intergenic
1098841128 12:75479420-75479442 GATGGAAAATGGAATGAGGTGGG - Intergenic
1098881047 12:75917848-75917870 GGTGGTAAAGATAGTGAGGAGGG + Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1099964828 12:89434748-89434770 TATGGAACAGATAATGAGGATGG - Intronic
1100115946 12:91304356-91304378 AATGCAAAAGAGTATGAGGAAGG - Intergenic
1100572848 12:95859073-95859095 GATGGTAAGGAGAAAGAGAACGG + Exonic
1100892093 12:99137009-99137031 CTTGGAAACGAGAATGAGGAAGG - Intronic
1101213909 12:102562004-102562026 GCAGGTAAAGAAAATGAGCAAGG + Intergenic
1101302015 12:103492834-103492856 GATGGGGAAGAGAATCAAGATGG - Intronic
1101385145 12:104250700-104250722 GATGATAAGGAGATTGAAGAAGG + Intronic
1101408918 12:104453332-104453354 CCTGGGAAAGAGAAGGAGGAAGG - Intergenic
1101416671 12:104514414-104514436 CATGGTGAAGAGGATGAGGAAGG - Intronic
1101585146 12:106079302-106079324 GATAGTAAGGAGCATGATGATGG - Intronic
1101626265 12:106445110-106445132 GAAGACAAAGAGAAAGAGGAAGG - Intronic
1101808504 12:108087011-108087033 GATGAGACAGAGAAGGAGGAAGG - Intergenic
1101927218 12:108982326-108982348 GATGGTGAAGATGATGATGATGG - Intronic
1102734185 12:115143513-115143535 GATGGTAAAGATAATGATGATGG - Intergenic
1102748603 12:115272158-115272180 GAAAGAAAAGAGAAAGAGGAAGG + Intergenic
1103162840 12:118744492-118744514 GAGAGAAAAGAGAAAGAGGAAGG + Intergenic
1103435870 12:120925004-120925026 GAAGGTAAAGAGATGGTGGAAGG + Intergenic
1103462677 12:121117515-121117537 CATGGTCAGCAGAATGAGGATGG + Intergenic
1104026604 12:125032110-125032132 GAAGGAAACCAGAATGAGGAGGG + Intergenic
1104744018 12:131199462-131199484 GATGGTAATGATGGTGAGGATGG - Intergenic
1105954362 13:25266369-25266391 GATTGTAAAGAGAAAAATGAAGG - Intronic
1106582842 13:31032542-31032564 GATGGAGAAGAGAACCAGGATGG - Intergenic
1106913889 13:34490864-34490886 CCAGGTAAAGAGAAAGAGGAAGG - Intergenic
1107002376 13:35564026-35564048 GAGGGTAGAGGGAAGGAGGAAGG - Intronic
1107043519 13:35973077-35973099 GATGGAGAAAGGAATGAGGATGG + Intronic
1107328749 13:39274072-39274094 CCTGGTAATGAAAATGAGGAAGG + Intergenic
1107671390 13:42749941-42749963 GATGGTAAACAGCAGCAGGATGG - Intergenic
1108426207 13:50303975-50303997 GAGGGTAGAGAGCAGGAGGAAGG - Intronic
1108475270 13:50810146-50810168 GAAAGTATAGAGAATGAGGATGG - Intronic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1110426046 13:75368740-75368762 TTTGATAAAGAGAATGAGGCCGG + Intronic
1110954925 13:81542274-81542296 AATGGTATAGAGAATGAAAAGGG + Intergenic
1111176998 13:84607886-84607908 GAGGTGAAAGAGTATGAGGAAGG + Intergenic
1112034083 13:95481598-95481620 GATATTTAAGAGAATGAGCATGG + Intronic
1112905683 13:104417753-104417775 GATAGTTAAGAGATAGAGGAAGG - Intergenic
1113095947 13:106663822-106663844 CATGACAAAGAGGATGAGGAAGG - Intergenic
1113186262 13:107688943-107688965 GATGGTGATGAGAAGCAGGAGGG + Intronic
1113912656 13:113851144-113851166 GATGGATAAATGAATGAGGATGG + Intronic
1114158904 14:20140455-20140477 CAAGATAAAGTGAATGAGGAAGG + Intergenic
1114282919 14:21211266-21211288 GATGAAAAAGAGGCTGAGGAAGG - Exonic
1114370415 14:22081118-22081140 GAAGGTAAAAAGAATGAGAGGGG - Intergenic
1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG + Exonic
1114906408 14:27133272-27133294 GAGGGTAAGGAGAAGGGGGATGG - Intergenic
1115123766 14:29969485-29969507 GGTGGTAAAGGGAATGAGAGAGG + Intronic
1115164811 14:30436284-30436306 GCTGGTAAACAGAATCAGGTGGG + Intergenic
1116648348 14:47559231-47559253 GATGGTAGAGGGAGGGAGGAGGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117099676 14:52333575-52333597 GAGGGCAAAGGGAATGGGGAGGG - Intergenic
1117652805 14:57924420-57924442 GAAAGTAAAGAGAATGAGCCTGG - Intronic
1117925185 14:60771653-60771675 GATAGTAGAGAGAGTGAGGTAGG - Intronic
1118041566 14:61922531-61922553 GAGGGTAGAGAGTAGGAGGAGGG + Intergenic
1118277092 14:64394891-64394913 GAAGGTAGAAAGAATGGGGAAGG - Intronic
1118583170 14:67325242-67325264 GAGGGTGAAGAGGAAGAGGAAGG - Intronic
1118674968 14:68174210-68174232 GATAGTCAAGGGAATAAGGATGG + Intronic
1119258863 14:73224816-73224838 GATCTTGATGAGAATGAGGACGG + Intergenic
1121090591 14:91179197-91179219 GATAGTAATGACACTGAGGAAGG + Intronic
1121207371 14:92180680-92180702 GATGGTAATGAGGAAGGGGAGGG - Intergenic
1121605870 14:95239338-95239360 GATGGGTAAGAAAATGAAGAAGG + Intronic
1121724925 14:96140274-96140296 GAGGGTAAAGAGAAGGGAGATGG - Intergenic
1121804766 14:96808061-96808083 GATTGAAAAGAGATTGAGTATGG + Intronic
1121962531 14:98274610-98274632 GATGGAAAAAAGAAAGAGAAAGG + Intergenic
1121982593 14:98467792-98467814 GGAGGTGAAGACAATGAGGATGG + Intergenic
1122005015 14:98695966-98695988 GATGGTGAGGATAATGATGATGG + Intergenic
1202831018 14_GL000009v2_random:30467-30489 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1124142936 15:27093313-27093335 GATGGGAAAACCAATGAGGAGGG - Intronic
1124454149 15:29824660-29824682 AATGGTAAAGATAATGTGAAAGG - Intronic
1124789494 15:32714238-32714260 GATGTTCACCAGAATGAGGAGGG - Intergenic
1124817546 15:33010624-33010646 GATTATAAAGAGAAAAAGGAAGG + Intronic
1125169168 15:36746277-36746299 AATAGTAGAGAGAAAGAGGAAGG + Intronic
1125356789 15:38824878-38824900 GATGGAAAGGAGAAAGAGCAGGG + Intergenic
1125386687 15:39144423-39144445 GATGGTGAAGATAGTGAAGATGG - Intergenic
1125569635 15:40706394-40706416 AATGATAAAGAGATAGAGGAAGG + Intronic
1126096003 15:45091175-45091197 GATGGTAATGGGACTGTGGATGG - Intergenic
1126290743 15:47074663-47074685 GTTGGTTGAAAGAATGAGGAAGG - Intergenic
1126349487 15:47729725-47729747 GATGGGTAAGAGAGTGAGGGAGG - Intronic
1126859803 15:52872737-52872759 AAGGGTCAAGTGAATGAGGAAGG - Intergenic
1127754608 15:62079226-62079248 GAAGTCAAAGAGAGTGAGGATGG + Intergenic
1127754917 15:62082911-62082933 GAAGACAAAGAGGATGAGGATGG - Intergenic
1128643079 15:69354198-69354220 GAAGGCAAAGAGAATGCAGATGG + Intronic
1129616769 15:77105010-77105032 TCAGGTAAAGAGAATGTGGAGGG - Exonic
1129705378 15:77791230-77791252 GAGGGACAAGAGGATGAGGAGGG + Intronic
1129912178 15:79237090-79237112 GATGATGATGATAATGAGGATGG + Intergenic
1129912188 15:79237143-79237165 GATGAAAAAGAGGCTGAGGAAGG + Intergenic
1130016787 15:80193566-80193588 TAAGGTAAAGAGAATCAGTAAGG - Intergenic
1130397149 15:83512659-83512681 GAAGGAAGAGAGAAGGAGGAGGG - Intronic
1130401171 15:83555694-83555716 GATGGAAAAGCAAATGAGGCTGG - Intronic
1130616541 15:85414511-85414533 GATGATATAGAGAATGAAGATGG + Intronic
1130680939 15:85996207-85996229 GAGGGTGAAGTGAATAAGGATGG - Intergenic
1131216408 15:90539660-90539682 GCTGGAAAAGAGCATGAAGAAGG + Intronic
1131548481 15:93335703-93335725 GATGCAAAAGAGAAAGAGGAAGG + Intergenic
1132049051 15:98591915-98591937 GATGCTAAATACAATGAGGTGGG + Intergenic
1133136850 16:3717967-3717989 AAAGCTAAAGCGAATGAGGAAGG + Intergenic
1133410870 16:5567732-5567754 GATGGTAATGACAATGTTGATGG - Intergenic
1133534789 16:6691429-6691451 GATGGTAAAGGTACTGAGGAAGG - Intronic
1133658778 16:7893692-7893714 AATGCTAATGAGAAAGAGGATGG + Intergenic
1133897621 16:9944465-9944487 GATGGTGAGGAGGAGGAGGATGG - Intronic
1134068219 16:11243487-11243509 GATGAAAAAGAGGCTGAGGAAGG + Intergenic
1134278859 16:12800757-12800779 GATGGGAAAGGGAAGGATGAGGG - Intronic
1134528079 16:14960043-14960065 GATAGAAAAGAAAATCAGGAAGG - Intergenic
1134812744 16:17181258-17181280 GATCGTGATGAGAGTGAGGAAGG - Intronic
1134819915 16:17238657-17238679 GATGCTGAAGACAAAGAGGAGGG - Intronic
1135932205 16:26747692-26747714 GAAGGGAAAGAGAAAGAGTAGGG - Intergenic
1135981836 16:27153870-27153892 GTAGGGAAAGAGAATAAGGAGGG + Intergenic
1137546575 16:49408614-49408636 GATGGGAAACAGGATGAGAAGGG + Intergenic
1137832933 16:51561714-51561736 GCTACTAAAGAGAATGAGGCAGG - Intergenic
1137871043 16:51950613-51950635 GAGGGAAAAGAGCATGAGAAGGG + Intergenic
1138103499 16:54273794-54273816 AATGGGAAAGAGGAAGAGGAAGG - Intergenic
1138271813 16:55701148-55701170 GCAGGTAAACAAAATGAGGATGG + Intronic
1138322960 16:56134262-56134284 GAAGGAAATGAGAATGAGAAAGG + Intergenic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1139179747 16:64732480-64732502 GAAGGGGAAGAGAATGAAGATGG - Intergenic
1139191880 16:64873671-64873693 TAGAGTCAAGAGAATGAGGATGG + Intergenic
1140901882 16:79375595-79375617 GATGGTAATGATGATGATGAAGG + Intergenic
1141065878 16:80913266-80913288 GATGGAAAAGAGCAGGTGGATGG + Intergenic
1141490194 16:84367688-84367710 GATGATGAAGAGGAGGAGGATGG + Intergenic
1141731064 16:85823334-85823356 GATGGCAATGATAATGATGATGG - Intergenic
1141932224 16:87213521-87213543 GATGGTGAGGAGAAGAAGGATGG + Intronic
1142111045 16:88331794-88331816 GGTGGTGATGAGAATGATGATGG - Intergenic
1142118329 16:88372744-88372766 GATGGTAAAGATGGTGATGATGG - Intergenic
1142118339 16:88372813-88372835 GATGGTAAAGATCATGATGATGG - Intergenic
1142118351 16:88372927-88372949 GATGGTAAAGATGGTGAAGATGG - Intergenic
1142118356 16:88372966-88372988 GATGGTGAAGATCATGATGATGG - Intergenic
1203139579 16_KI270728v1_random:1752362-1752384 GATGGTGAAGAGTAACAGGAAGG - Intergenic
1143178334 17:4969074-4969096 GATGATCAAGAGGATGAGTAAGG + Intronic
1143184316 17:5001076-5001098 GGTGGTAAGGACAATGATGAGGG + Intronic
1143729345 17:8872052-8872074 GAGGGTAAAGAAATTGAGGAGGG - Intergenic
1144140397 17:12342106-12342128 GATGTTAGAAAGTATGAGGAAGG - Intergenic
1145088481 17:19965098-19965120 GATGGTAAAGTCAATGTGGGTGG - Intronic
1146110003 17:30080728-30080750 GAGGAAAAAGAGTATGAGGATGG - Intronic
1146179201 17:30686592-30686614 GTTGGTAAAGAAATTGAGGAGGG - Intergenic
1148020812 17:44552195-44552217 GATGGTAAGGAGAGAGAGTAAGG - Intergenic
1148601248 17:48895744-48895766 CATGGCGAAGAGGATGAGGAAGG - Exonic
1149639679 17:58194730-58194752 GGTGGTAAAGAGAAGGAGAGGGG - Intronic
1150711151 17:67531901-67531923 GATGGAAAAGAGAGAGGGGAGGG - Intronic
1150944065 17:69725007-69725029 GATGGGGAAGAGAATCAGGTCGG - Intergenic
1151274014 17:73020338-73020360 CATGGTAGAGAGAATGAGAGAGG - Intronic
1151550456 17:74819721-74819743 GATGGAAACAAGAGTGAGGAGGG - Intronic
1151769979 17:76154300-76154322 GATGTTATAGAGGAAGAGGATGG - Exonic
1152026014 17:77809801-77809823 GATGGTAAAGATGATGGTGATGG + Intergenic
1152261586 17:79270119-79270141 AATGGCAAAGGGAAGGAGGACGG - Intronic
1153503333 18:5770602-5770624 TAGGGTAAAGAGGATGAGGGGGG + Intergenic
1153785118 18:8527894-8527916 GATGTTAAAAAGAATGAGGCAGG + Intergenic
1154121876 18:11658741-11658763 GATGGAGAAGGGAATTAGGAGGG - Intergenic
1155101125 18:22611181-22611203 GATGCTAGAGAGAGTGAAGAAGG + Intergenic
1155284760 18:24276182-24276204 GATAGTACACAAAATGAGGAGGG + Intronic
1156482660 18:37445881-37445903 GATGATAAGGAGGAGGAGGATGG - Intronic
1156577123 18:38330272-38330294 GATGGTATAGAGTAAGAGGATGG - Intergenic
1157172546 18:45421229-45421251 GATGTTAAATAGAATGTGGGTGG - Intronic
1157731842 18:50010937-50010959 TGTGGTATAGAGAAAGAGGATGG - Intronic
1158778337 18:60615014-60615036 AATGAGCAAGAGAATGAGGAGGG + Intergenic
1158814458 18:61077847-61077869 GAAGGAAAGGGGAATGAGGATGG - Intergenic
1158911262 18:62065179-62065201 GATAGGAAAGAGAAAGAGAAAGG - Intronic
1159056498 18:63470919-63470941 GATGGTACAGAGGAGGAGAAGGG + Intergenic
1159088874 18:63824090-63824112 GATGATAATGAGGATGATGATGG + Intergenic
1159318607 18:66814879-66814901 GAGGGTAAGGAAAATGAGGAAGG + Intergenic
1161899428 19:7107093-7107115 GATGGTAATGGTGATGAGGATGG + Intergenic
1161899465 19:7107520-7107542 GATGGTGAAGGTGATGAGGATGG + Intergenic
1161922839 19:7279447-7279469 GAGGGAGAAGAGAGTGAGGAGGG + Intronic
1162053108 19:8046845-8046867 GATGGGGAGGAGAAGGAGGAGGG - Intronic
1162365056 19:10243541-10243563 GAAGGTACAGAGCATGAGGTCGG - Intergenic
1162877813 19:13633905-13633927 GAAGGAAAAGAGAGAGAGGAAGG - Intergenic
1162979423 19:14228978-14229000 GTTGGTAAAGAAATTGAGGAGGG + Intergenic
1163604599 19:18267065-18267087 GTTGGTAAAGAAAACGAGGGCGG - Exonic
1164196285 19:22965577-22965599 AATTCTAAAGAGAAGGAGGAAGG - Intergenic
1164316025 19:24088577-24088599 GATGATAAAGTGAATTAGGGAGG - Intronic
1166430617 19:42723649-42723671 GATGTTAAAAATAATGAAGAGGG + Intronic
1166469474 19:43066229-43066251 GATGTTAAAAATAATGAAGAGGG + Intronic
1166480605 19:43169767-43169789 GATGTTAAAAATAATGAAGAGGG + Intronic
1166670634 19:44707728-44707750 GCTGGGAAGGAGACTGAGGAAGG - Intronic
1166960294 19:46492923-46492945 GAAGGGAAAGAGGAGGAGGAGGG - Exonic
1166979408 19:46623887-46623909 CATGGCAAAGAGGATGAGCATGG + Exonic
1167223666 19:48221032-48221054 GAGGGAAAAAAGAAAGAGGAAGG + Intronic
1167725016 19:51205553-51205575 CATGAGAAAGAGAGTGAGGAAGG - Intergenic
1168090523 19:54080045-54080067 GAAGGGAAAGAGAGAGAGGAAGG + Intronic
1168322748 19:55519749-55519771 GATGGTAATGATGATGATGATGG + Intergenic
1168361774 19:55746894-55746916 GATGGTGAAGATGATGATGATGG + Intergenic
1168368786 19:55813695-55813717 GATGATCAAGAGAAGCAGGAAGG + Intronic
1168559448 19:57370859-57370881 GAGGGTGTAGAGATTGAGGAAGG + Intronic
1202641677 1_KI270706v1_random:97306-97328 AATAGTAAAAAGAATGAGGTAGG - Intergenic
925423216 2:3728195-3728217 GCTGGGAACGAGAAAGAGGAAGG + Intronic
925685753 2:6471454-6471476 GATGGGAATGAGAAAGAGAAAGG - Intergenic
926132431 2:10312565-10312587 GATGGTGATGATGATGAGGATGG - Intronic
926759954 2:16269678-16269700 GAAGGATAAGAGACTGAGGATGG + Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
927433034 2:23042937-23042959 GATGGGAAGGAGGATGAAGAGGG - Intergenic
927785675 2:25972838-25972860 GAGGGGAAAGAGAAAGAGGTGGG - Intronic
928251186 2:29682157-29682179 GATGGCAAAGAGATTGAGGAGGG + Intronic
928301336 2:30127946-30127968 GAGGGTGAAGGGAATGAGTAGGG - Intergenic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
930649007 2:53945553-53945575 GATGGGAAAGGTAAAGAGGAAGG + Intronic
931786332 2:65622425-65622447 AGGGGAAAAGAGAATGAGGAGGG + Intergenic
932503200 2:72203111-72203133 GATGATAATGACAATGAAGATGG + Intronic
932752031 2:74377371-74377393 GAGGGGAAGGAGAAAGAGGAGGG - Intronic
933413548 2:81954912-81954934 GGTGGAAGAGAAAATGAGGAAGG - Intergenic
933422012 2:82060642-82060664 GATAGAAAAGAGAGTGAGAATGG - Intergenic
933436990 2:82260882-82260904 GCTGGGAAAGAGAGAGAGGAGGG + Intergenic
934587501 2:95515304-95515326 GATGGTGATGAGAATGCAGATGG + Intergenic
934655709 2:96116069-96116091 GATGGTAAAGAGAATGAGGAAGG + Exonic
935791059 2:106590591-106590613 GATGAGAAAGAGAAAGAAGAGGG - Intergenic
936269688 2:111040434-111040456 GGTGGATAAGGGAATGAGGAAGG - Intronic
936679393 2:114753054-114753076 GCTCCTGAAGAGAATGAGGAGGG + Intronic
936708855 2:115107368-115107390 GATGGGAAAGACAATAAAGAAGG + Intronic
936895653 2:117424561-117424583 GATATTTAAGAGGATGAGGAGGG + Intergenic
936988872 2:118340810-118340832 GTTGGAAAAGAGAACCAGGAAGG - Intergenic
937062477 2:118990861-118990883 GATGGCAAAGGGGCTGAGGATGG + Intronic
937504347 2:122519837-122519859 GCTGGAAAAGATAGTGAGGAGGG + Intergenic
937528390 2:122798986-122799008 GAGGGGAAGGAGAAAGAGGAGGG - Intergenic
937995230 2:127689508-127689530 GAAGGAAAAGAGAAGGAGCAGGG + Intergenic
938202096 2:129380664-129380686 AATGGTTAAGAACATGAGGAGGG - Intergenic
939119670 2:138101323-138101345 GATGATGAAGTGAATGAGGACGG - Intergenic
939820063 2:146946643-146946665 GAGGGTGGAGAGAAGGAGGAGGG + Intergenic
940344658 2:152616779-152616801 GAAAGTAAGGAGAAAGAGGAGGG - Intronic
940635271 2:156291692-156291714 GATGGTGGAGAGAAGGAGGTTGG - Intergenic
940921945 2:159317274-159317296 GCTGGAAAAGAGAAGGAGCATGG + Intergenic
941039856 2:160609103-160609125 GTTGGTAACTAGAATGAGAAAGG + Intergenic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
942070417 2:172311097-172311119 GATGGTAATGTGGATGAAGATGG + Intergenic
942071647 2:172321596-172321618 GATAGGAAAGGGAATGAGAATGG - Intergenic
943173526 2:184435570-184435592 AAGAGTAAAGAGAATGTGGAAGG + Intergenic
943332447 2:186575810-186575832 AATGGTAGAGAGAATAAAGATGG + Intergenic
943549105 2:189316589-189316611 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
943601315 2:189924151-189924173 GATGAAAAAGAGGCTGAGGAAGG + Intronic
943975132 2:194466297-194466319 GATGAAAAAGAGGATGAGGATGG + Intergenic
944099098 2:196003177-196003199 GATGGAAAAGAGAATGAGGAAGG + Intronic
944473446 2:200080098-200080120 GGAGGGAAAGAGGATGAGGAGGG + Intergenic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946505026 2:220290111-220290133 GATGCTCAGGAGACTGAGGAAGG - Intergenic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
947082030 2:226409700-226409722 GAAGGCAAAGAGAAGGAGGCAGG + Intergenic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947321826 2:228927601-228927623 TATGGGAAAGAAAAGGAGGAAGG + Intronic
947450315 2:230202451-230202473 AAAAGTACAGAGAATGAGGATGG - Intronic
948147439 2:235718477-235718499 GATGGTACACAGAACAAGGAGGG - Intronic
1169278369 20:4248388-4248410 GATGGTGCAGAGGCTGAGGATGG + Exonic
1169613020 20:7404641-7404663 GTTGTTAAAAAGAATGAGAATGG - Intergenic
1169832727 20:9841749-9841771 GAAGGTAAAGAGAATGAGCTGGG - Intergenic
1171269255 20:23800586-23800608 GATGGTACTGAGAGTGATGATGG - Intergenic
1171538707 20:25925056-25925078 GTTGGTTGAAAGAATGAGGAAGG + Intergenic
1171802325 20:29635226-29635248 GTTGGTTGAAAGAATGAGGAAGG - Intergenic
1171841649 20:30220371-30220393 GTTGGTTGAAAGAATGAGGAAGG + Intergenic
1171877959 20:30595995-30596017 GATAGTAAGGAGGATGATGATGG - Intergenic
1172415433 20:34763199-34763221 GAAGATAAAGAAATTGAGGAGGG - Intronic
1173169590 20:40713350-40713372 GGTGGTCAAGGGAATGAGGAGGG - Intergenic
1174498578 20:50967343-50967365 GATGGGAAAGAGCATGAGGGAGG - Intergenic
1175038571 20:56023698-56023720 GAGGGTGAAGAGGGTGAGGAGGG + Intergenic
1175281260 20:57805445-57805467 GATGGACAAGATACTGAGGATGG - Intergenic
1175670154 20:60895484-60895506 GATGGTGATGATAATGATGATGG + Intergenic
1175670161 20:60895561-60895583 GATGGTGATGATAATGATGATGG + Intergenic
1175906478 20:62382129-62382151 GATGGTGAAGATGATGATGATGG + Intergenic
1175971917 20:62690781-62690803 CATGGTAAACGGAATGAGGTTGG + Intergenic
1176610206 21:8875306-8875328 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1177475316 21:21612983-21613005 AATGGAAAAGAAAATGAGAAGGG + Intergenic
1177915928 21:27088202-27088224 AAAGGAAAAGAGAATGAAGAAGG - Intergenic
1178750486 21:35297892-35297914 TATGTGAAAGAGAAAGAGGAAGG - Intronic
1178991609 21:37361348-37361370 GATGGCTAGGAGAATGAAGATGG + Intergenic
1179244937 21:39624868-39624890 GATTTTCAAGAGAGTGAGGATGG - Intronic
1179469331 21:41600143-41600165 GAAGGTAAAGGGACTGACGAGGG - Intergenic
1180690093 22:17706736-17706758 AAATGAAAAGAGAATGAGGAGGG - Intronic
1181054120 22:20251997-20252019 GATGGTGATGAGGATGAGGATGG - Intronic
1181561536 22:23705553-23705575 GATGGTAAATTAAATGAGCAAGG + Intergenic
1181866016 22:25855982-25856004 GAGGGTAAAGAGTGGGAGGAGGG - Intronic
1181907315 22:26209691-26209713 GAAGGAAAAAAGAAAGAGGAAGG + Intronic
1182090142 22:27588950-27588972 GATGGTGATGATAATGATGATGG - Intergenic
1182567396 22:31210578-31210600 AATGTGAGAGAGAATGAGGAGGG + Intergenic
1182816279 22:33166836-33166858 GAAGCAAAAGAGAATGAGAAAGG + Intronic
1182857290 22:33529091-33529113 GATAGGAAAGATACTGAGGAAGG - Intronic
1183071369 22:35398938-35398960 GCTGTTAAACAGAATGAGGCCGG + Intergenic
1183091095 22:35522726-35522748 GAAGGAAAAAAGAAAGAGGAAGG - Intergenic
1183188388 22:36305762-36305784 GGTGGAAAAGAGAAGGAGGTGGG + Intronic
1183365886 22:37406667-37406689 GATGGTAATTAGTATGAGGCAGG - Intronic
1184286686 22:43475951-43475973 GATGGTAATGAGGATGATTACGG + Intronic
1184380816 22:44143878-44143900 GAGGGGGAAGAGAGTGAGGAAGG - Intronic
1184753471 22:46502483-46502505 GAAGGAAAGGAGAAAGAGGAGGG + Intronic
1185003429 22:48261062-48261084 GATGATAACGAGGAAGAGGATGG - Intergenic
1185003451 22:48261284-48261306 GATGGTGATGAGGAGGAGGATGG - Intergenic
1185089383 22:48757251-48757273 GATGGGAAGGAGGAGGAGGAGGG + Intronic
1185089412 22:48757352-48757374 GATGGGAAGGAGGAGGAGGAGGG + Intronic
949147230 3:716900-716922 TAAGGTAAATAGAATGAGCAGGG + Intergenic
949538132 3:5011722-5011744 GCTGGTCCCGAGAATGAGGAAGG - Intergenic
949879716 3:8651833-8651855 GATGGTGAAGAGGCAGAGGAGGG - Intronic
950168736 3:10821341-10821363 CATGGCAAATAGAATGATGATGG + Intronic
950182247 3:10922789-10922811 CATGCTAAAGGGAATGGGGAAGG + Intronic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
951156272 3:19357338-19357360 TATGGCAAAGAAAATGTGGATGG + Intronic
951590860 3:24262817-24262839 GACGGTAAACACCATGAGGAAGG + Intronic
951705599 3:25541243-25541265 GAGGCTGAAGAGGATGAGGAGGG - Intronic
951873483 3:27393844-27393866 GATGGAAGACAGAATGAGGATGG + Intronic
951940760 3:28076238-28076260 GGTTGGAAAGAGAATGAGAAAGG - Intergenic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952429558 3:33209597-33209619 GAAGGAAGAGAGAAAGAGGAAGG - Intronic
952553108 3:34501285-34501307 GATGGAAAAGAGAACGTGCATGG - Intergenic
952567577 3:34677942-34677964 AATGGCAAACAGAATGAGGCTGG - Intergenic
953014177 3:39056933-39056955 GATTGTAATGAGAAGAAGGAGGG + Intronic
953023556 3:39131347-39131369 GATAGTAGAGATAATAAGGATGG + Intronic
953089011 3:39705051-39705073 GATGGTAAAGAGAATTTGGGGGG + Intergenic
953450376 3:43000473-43000495 GATGCTAAAGAGAGAGATGAAGG + Intronic
953544828 3:43856767-43856789 GATGGTAAATGGAGAGAGGAAGG + Intergenic
953688417 3:45096322-45096344 GCTGTTAAAAAGAATGAGGGAGG + Intronic
953702970 3:45210828-45210850 GAGGGTAAAGTGGATGGGGAGGG + Intergenic
953787692 3:45923052-45923074 GCTGGACAAGAGAATGAGAATGG - Intronic
954076186 3:48182970-48182992 CATGGTCAAGAGAATCAGAATGG + Exonic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
954920431 3:54186135-54186157 GATGGGAATGAGGGTGAGGATGG + Intronic
955033862 3:55247612-55247634 CAAGGTAAAGAGAAGGAGAAAGG - Intergenic
955545724 3:60027474-60027496 GATGGTAAAGACAGTGACAATGG - Intronic
955603541 3:60673993-60674015 GAGGATAGAGAGAATGAGGGAGG - Intronic
957411954 3:79852734-79852756 GATGGTAAAGAGAGTCAGAGGGG + Intergenic
957507413 3:81140816-81140838 GAAGGGAGGGAGAATGAGGAAGG + Intergenic
957888310 3:86320313-86320335 GAGGGTGAAGGGAAGGAGGAGGG - Intergenic
958054648 3:88393878-88393900 GATAGTACAGAGGATGAGGAGGG + Intergenic
958617382 3:96512633-96512655 AATGGTAAAGTAAATTAGGATGG - Intergenic
958929247 3:100191336-100191358 GAGGGTGAAGAGAGTGAGGGAGG - Intronic
959302751 3:104623409-104623431 GATAGTAAAAAGAAAGATGAGGG + Intergenic
959430843 3:106252918-106252940 GAGGGTAAAGGGTGTGAGGAGGG + Intergenic
959912438 3:111778925-111778947 GATGCTAAAGGGAATCAGTAAGG - Intronic
960425550 3:117502586-117502608 GATTGTTAAGAGAAGGAAGAAGG + Intergenic
960502811 3:118457384-118457406 AATGGAAATGAGAATGAGAAAGG + Intergenic
960928591 3:122821260-122821282 GATGGAAAAGTGAATGAGAGAGG - Intronic
960997346 3:123348858-123348880 GAAGGGCAGGAGAATGAGGAGGG - Intronic
961811339 3:129523508-129523530 GGTAGAAAAGAGAAAGAGGAAGG + Intergenic
962430673 3:135316379-135316401 GATGGTGAAGAGAAAAATGAAGG + Intergenic
962800839 3:138889255-138889277 CATGGCAAAGAGGATGAGGAAGG + Intergenic
963671037 3:148252654-148252676 GATGGTGTAGAGGATGAGAATGG + Intergenic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
964165579 3:153700979-153701001 GAAGGAAGAGAGAATGGGGACGG - Intergenic
965376548 3:167931613-167931635 GATGGTGATGATAATGATGATGG - Intergenic
965582140 3:170280001-170280023 GATGGTAATAAGAATGGGGAGGG - Intronic
965863692 3:173178789-173178811 GAAGGTAAAGGGAAAGAGGTTGG - Intergenic
965884029 3:173422602-173422624 GCTGGCAAGGAGAAAGAGGAAGG - Intronic
965954212 3:174348668-174348690 GAAGGAAAAGAGAGAGAGGAAGG + Intergenic
966062325 3:175773096-175773118 GATGGTAATGAGAAAGTGGAAGG + Intronic
967198540 3:187050615-187050637 GAAGGAAAAGAGAGAGAGGAAGG + Intronic
967312953 3:188123378-188123400 GTTGTTTTAGAGAATGAGGAAGG - Intergenic
967364486 3:188670354-188670376 GATGGGAGAAAGAGTGAGGAAGG + Intronic
967466412 3:189811193-189811215 GATGAGAAAGAGGATGAGAATGG + Intronic
967549437 3:190773255-190773277 GAAGGAGAAGAGAATGAGTAAGG - Intergenic
967752585 3:193131181-193131203 GATGGGAAAGAGAAAGCAGAGGG - Intergenic
1202736888 3_GL000221v1_random:10092-10114 AATAGTAAAAAGAATGAGGTAGG + Intergenic
969108854 4:4828818-4828840 GGAGAGAAAGAGAATGAGGAGGG - Intergenic
969208770 4:5670235-5670257 GATGGTAAAGATAGTTATGATGG - Intronic
969404404 4:6979507-6979529 GCTGGTCAAGAGACTGAGGCAGG + Intronic
969835646 4:9838225-9838247 GATGGTAATGATGATGACGATGG + Intronic
970172595 4:13304642-13304664 AATAGTAGAGAGAAAGAGGAAGG - Intergenic
970260132 4:14215864-14215886 GATGATAAGGAAAATGAGGAAGG + Intergenic
970958823 4:21848507-21848529 AATGCTAATGAGAATGATGATGG - Intronic
972578669 4:40375599-40375621 GAGGGGAAAGAGGATGAGTATGG - Intergenic
972757231 4:42060114-42060136 TATGGTAAAGCCAATGTGGAGGG - Intronic
972790245 4:42364909-42364931 GGAGGGAAAGAGAAAGAGGAAGG - Intergenic
973385188 4:49507822-49507844 AATAGTAAAAAGAATGAGGTAGG - Intergenic
974269858 4:59635926-59635948 AATGGAAAAGAGAAAAAGGAAGG + Intergenic
974597003 4:64027245-64027267 GATGGGAATGAGAAGGAGGTGGG - Intergenic
975090534 4:70397386-70397408 GATGGTGTAGAGCAGGAGGAGGG + Intergenic
975376975 4:73657551-73657573 GATGGTCAAGAGATTGAGTGCGG + Intergenic
975390789 4:73814952-73814974 GGAGGCAAAGAGAATGAGGTAGG + Intergenic
975659204 4:76671533-76671555 GTTAGCAAAGAGAATGAAGAGGG - Intronic
976995215 4:91423316-91423338 GATGCTAAGGAGACTGAGGCAGG + Intronic
977594226 4:98860641-98860663 GATTGTTATGAGAATTAGGAGGG - Intergenic
977675882 4:99746251-99746273 GATAGTACAGAGAATTTGGAAGG + Intergenic
977811527 4:101361147-101361169 GATGGTAAAGGGAATCTGGGAGG + Intergenic
979128574 4:117009404-117009426 GATGGAAAAGGGAAGGAGGGAGG + Intergenic
979132154 4:117060557-117060579 GAAGGTAAACAGAGTGATGAAGG - Intergenic
979717971 4:123864527-123864549 GATGGTGAGGAGAACAAGGATGG - Intergenic
979749652 4:124262994-124263016 GAAGGAAAAGAGAAAGAGGAGGG - Intergenic
980061048 4:128130046-128130068 TACTGTCAAGAGAATGAGGAAGG + Intronic
980475587 4:133310239-133310261 GGTGTTAAAGAGAAAGAAGAAGG - Intergenic
980726764 4:136771814-136771836 GAGGGATAAGAGAATGAGTAGGG - Intergenic
980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG + Intergenic
980981792 4:139660602-139660624 GATGGCAGAGAGAATGGGCAGGG + Intergenic
981201055 4:141979898-141979920 GAAGGAAAAGAGAATAAGCAAGG - Intergenic
982339659 4:154283888-154283910 GCTGGAAAGGATAATGAGGATGG - Intronic
983425178 4:167574853-167574875 GATGGAAAAGAGAATCGTGAAGG - Intergenic
984349390 4:178570849-178570871 CAAGGTAGTGAGAATGAGGAGGG + Intergenic
984361551 4:178741369-178741391 GATGGTGAAAAGAAAGAGAAAGG - Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984979715 4:185267993-185268015 GAGGAGGAAGAGAATGAGGAGGG + Intronic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
1202769050 4_GL000008v2_random:183180-183202 AATAGTAAAAAGAATGAGGTAGG - Intergenic
985807735 5:2059487-2059509 GATGGGTATGAGAATGAGGAGGG + Intergenic
985857320 5:2439951-2439973 GATGGTGATGATAATGATGATGG - Intergenic
986436750 5:7741647-7741669 GATGATGATGATAATGAGGATGG - Intronic
987272259 5:16323478-16323500 AGTGGTAAAGTGCATGAGGATGG + Intergenic
987432166 5:17848091-17848113 GAGGGAAAAGAGAGTGAGGCAGG + Intergenic
987515046 5:18895109-18895131 AATGCCAAAGAGCATGAGGATGG - Intergenic
987705212 5:21454776-21454798 GATGGTAGAGAGAACATGGAAGG - Intergenic
987731626 5:21780959-21780981 GAAAACAAAGAGAATGAGGATGG + Intronic
988292650 5:29309338-29309360 GATGTGAAACAGAATGATGATGG - Intergenic
988372893 5:30395184-30395206 GAAGGAGAAGAGAGTGAGGATGG - Intergenic
989142325 5:38213879-38213901 TAGAGAAAAGAGAATGAGGAGGG + Intergenic
989368552 5:40681571-40681593 GACGGTGGCGAGAATGAGGAAGG - Exonic
989432488 5:41372057-41372079 GGGGGTAGAGAGAATAAGGATGG - Intronic
989469206 5:41795404-41795426 GATTGTGAAGGGAATGGGGATGG - Intronic
989553316 5:42761312-42761334 GCTGTTAAAAAGAATGAGGTAGG + Intronic
989766879 5:45097621-45097643 GATCCTAAAGAAAAAGAGGAAGG - Intergenic
990546030 5:56822567-56822589 AATGTTCAAGAGAATGAAGATGG - Intronic
990695068 5:58407309-58407331 GATGGTAAATGGAAAGGGGATGG + Intergenic
990847326 5:60157486-60157508 GAAGATTTAGAGAATGAGGAGGG + Intronic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991998541 5:72412850-72412872 GACAGTTAAGAGAATGAGCAAGG + Intergenic
992544689 5:77801136-77801158 GATTGTAAAGAGAATGTATATGG + Intronic
992549470 5:77847195-77847217 GGGAGAAAAGAGAATGAGGATGG - Intronic
993346625 5:86791845-86791867 TATGGTAAAAAGAAAGAGTAAGG - Intergenic
993401786 5:87462333-87462355 GGTGATAAAGAGATTGATGATGG - Intergenic
993514282 5:88811155-88811177 GATGGTAAACAGACTGATGTAGG + Intronic
993697088 5:91074318-91074340 GAGGGTAGAGGGAAAGAGGAGGG - Intronic
993850083 5:92997386-92997408 GATGATAAAGAGACTGAAGAAGG - Intergenic
993957047 5:94246997-94247019 GAAGATGAAGAGAATGAAGAAGG - Intronic
994903475 5:105805262-105805284 GAAGATAAATAGATTGAGGAAGG - Intergenic
995006593 5:107204017-107204039 GCTGGTAAAGAAAATGAGTGGGG + Intergenic
995260251 5:110095778-110095800 GATGTTAAAGAGACTGGGAAGGG + Intergenic
995387763 5:111607144-111607166 GCTGGGGAAGAGAAGGAGGAGGG - Intergenic
995701891 5:114945414-114945436 GAGGGTAGAGAGTAGGAGGAGGG - Intergenic
996120910 5:119671107-119671129 GAAGGAAGAGAGACTGAGGAGGG - Intergenic
996273588 5:121638148-121638170 GCTGGTAAAGTGAATGAGAAGGG + Intergenic
996469897 5:123847788-123847810 GATGGAAATGATAATGAGAATGG - Intergenic
996593425 5:125174653-125174675 AGTGGCAATGAGAATGAGGAAGG - Intergenic
996742419 5:126813056-126813078 AATGGTAAAAAGAAAAAGGAAGG - Intronic
997811872 5:136978667-136978689 GATGACAAAGAGGATGAGGTCGG - Exonic
998002133 5:138633703-138633725 GATGGTAAGGGGGATGGGGATGG - Intronic
998100636 5:139430869-139430891 GATTTTAAAAAGAATGAGGTAGG - Intronic
998537801 5:142950964-142950986 GAAGGGAAAGGGAAAGAGGAAGG - Intronic
999055318 5:148568968-148568990 GGTGTTAAAAAGAATGAGAAGGG + Intronic
999115004 5:149155178-149155200 GATGGTAAAAAGGAGGAGCAGGG - Intronic
999518269 5:152322741-152322763 GATAGAAATGAGCATGAGGAGGG - Intergenic
999550363 5:152679796-152679818 GATAGTAAATAGAATGAGCTAGG - Intergenic
999644087 5:153700937-153700959 GGTGGTAAAGGGAATAAGAAAGG - Intronic
999908465 5:156169631-156169653 GATGCTGGAGAGAATGAGGTGGG + Intronic
1000048276 5:157539720-157539742 GATGCTAAGGAGAAAGAGAAAGG - Intronic
1000380349 5:160623330-160623352 GCATGTAAAGTGAATGAGGAAGG + Intronic
1001106179 5:168856568-168856590 TTAGGCAAAGAGAATGAGGACGG + Intronic
1001319558 5:170669028-170669050 GATGAGAAAGAGAAGCAGGAGGG - Intronic
1001971166 5:175956201-175956223 GATGGTAATGTGACTTAGGAGGG - Intronic
1001976684 5:176006145-176006167 GGGGGTAAAGAGAATGAGACAGG + Intronic
1001981141 5:176037687-176037709 GATGGAGAAGGGAAAGAGGATGG + Intergenic
1002236319 5:177806379-177806401 GATGGAGAAGGGAAAGAGGATGG - Intergenic
1002246276 5:177887576-177887598 GATGGTAATGTGACTTAGGAGGG + Intergenic
1003411355 6:5865614-5865636 GAGGGTAATGAGAGTGGGGAAGG + Intergenic
1004146343 6:13070466-13070488 GAGGGTAAAGAGGCTTAGGAGGG + Intronic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1005478884 6:26235977-26235999 GGTTGTACAGAGAAAGAGGAAGG - Intergenic
1005822108 6:29606853-29606875 TATGGTCAGGAGAATGAGCAGGG - Intronic
1006191872 6:32214258-32214280 GGTTGTAAAGAGAAAGGGGAGGG + Intronic
1006671595 6:35732688-35732710 ACTGGTAAAGAGAATGAGGAAGG + Intergenic
1006707865 6:36037539-36037561 GATTGTAGAGAGAAAGGGGAAGG + Intronic
1006853640 6:37117460-37117482 GATGGCAGCGAGAATGAGCATGG + Intergenic
1008092615 6:47308832-47308854 GAGGGTAAAGGGATTGAGGAGGG + Intronic
1008251642 6:49247009-49247031 GACGGTAGAGAGAGGGAGGAGGG + Intergenic
1009362624 6:62834378-62834400 GAGGGTAAAGAATAGGAGGAAGG - Intergenic
1010456325 6:76060128-76060150 TATGGTGAAGAGAATTAAGATGG + Intronic
1010791771 6:80073566-80073588 GATGGAAAAGAGAAGGAAAATGG - Intergenic
1010880946 6:81170941-81170963 GATGTGAAATAAAATGAGGAGGG - Intergenic
1011309783 6:85969138-85969160 GAGGTTAAATAGAATAAGGATGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1013623881 6:111918300-111918322 GAAGGAAAAAAGAAAGAGGAAGG - Intergenic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1014284709 6:119483969-119483991 GCTGGTGAAGAAAAAGAGGATGG + Intergenic
1014708108 6:124773290-124773312 AATGGGAAGGAGAAAGAGGAGGG + Intronic
1015101703 6:129489336-129489358 GAAGGGAGAGAGAATGAGGGAGG - Intronic
1015231781 6:130923160-130923182 GATTGAAGAGAGAATGAGGAAGG - Intronic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015898992 6:138045613-138045635 GAGGGAAAGGAGGATGAGGATGG - Intergenic
1017074993 6:150609754-150609776 AGTGGTACAGAGAAGGAGGATGG + Intronic
1017741277 6:157408995-157409017 GATGGAAAAGAAAAGAAGGAGGG + Intronic
1018103434 6:160461734-160461756 GATGGTGATGAGGATGATGATGG - Intergenic
1018110767 6:160535006-160535028 GATGGTAATGATAATGGTGATGG + Intronic
1018190349 6:161304838-161304860 GATGGTAAATGGAATGAGGAAGG + Intergenic
1018276664 6:162139511-162139533 CAGGGTAAAGAGAATCAGCATGG + Intronic
1018855506 6:167671754-167671776 GATGGTAGTGAGACTGAAGATGG - Intergenic
1018887293 6:167950777-167950799 GAGGGTGAGGAGGATGAGGATGG + Intronic
1018961017 6:168448516-168448538 GATGGGGAGGAGGATGAGGATGG + Intronic
1018996612 6:168715073-168715095 GATGGTGAAGAGGAGGGGGATGG + Intergenic
1018996644 6:168715289-168715311 GATGGTGAGGAGTAGGAGGATGG + Intergenic
1018996714 6:168715783-168715805 GATGGTGAGGAGGAAGAGGATGG + Intergenic
1019327603 7:445993-446015 GATGGAGAAAAGAAGGAGGAGGG + Intergenic
1019369627 7:654681-654703 GATGGTGAAGGTGATGAGGATGG - Intronic
1019419107 7:942491-942513 GAAGGGAGAGAGGATGAGGAAGG + Intronic
1019419148 7:942652-942674 GAAGGGAGAGAGGATGAGGAAGG + Intronic
1019419183 7:942779-942801 GAAGGGAGAGAGGATGAGGAAGG + Intronic
1019419213 7:942888-942910 GAAGGGAGAGAGGATGAGGAAGG + Intronic
1019419261 7:943079-943101 GAAGGGAGAGAGGATGAGGAAGG + Intronic
1019419280 7:943163-943185 GAAGGGAGAGAGGATGAGGAAGG + Intronic
1019419333 7:943362-943384 GAAGGGAGAGAGGATGAGGAAGG + Intronic
1019419388 7:943570-943592 GAAGGGAGAGAGGATGAGGAAGG + Intronic
1019490238 7:1309566-1309588 GATGGTAAAGATAATGATAATGG + Intergenic
1019867359 7:3724761-3724783 GAAGGAAAAAGGAATGAGGAGGG + Intronic
1020863280 7:13522142-13522164 GGTGGTAAAGAGACTCAGAATGG - Intergenic
1021017635 7:15554184-15554206 GATTGAGAAGAGAAAGAGGAAGG - Intronic
1021094733 7:16523058-16523080 GATGGTAAAGAGAAAAATGAAGG + Intronic
1021545890 7:21812540-21812562 GGTGGCAAAGAGGCTGAGGAGGG + Intronic
1021760265 7:23896755-23896777 GCTAGTAAAGAGATTCAGGAAGG - Intergenic
1022082977 7:27042508-27042530 GTAGGGGAAGAGAATGAGGACGG - Intergenic
1022416691 7:30184349-30184371 GATGATGAAGATAATGATGATGG - Intergenic
1022547856 7:31205681-31205703 AAAGGAAAAGAGAATGAGTATGG - Intergenic
1022935419 7:35170376-35170398 GAGGGTGAAGGGTATGAGGAGGG + Intergenic
1023230119 7:38019090-38019112 GATAATAAAGATAATGAAGAAGG + Intronic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1024334577 7:48194319-48194341 GATGGTGGAGATAATGATGATGG + Intronic
1024382568 7:48715246-48715268 GAGAGTAAAGAGAATGGGGAAGG - Intergenic
1024400811 7:48923021-48923043 GACCGCAAAGAGAATAAGGAGGG + Intergenic
1025290094 7:57710978-57711000 GTTGGTTGAAAGAATGAGGAAGG + Intergenic
1025770600 7:64501664-64501686 GATGAAAAAGAGGCTGAGGAAGG + Intergenic
1026474908 7:70726900-70726922 GAGAGGAAAGAGAATGAGGAAGG - Intronic
1026992975 7:74598109-74598131 GATAGTCAAGAGGATGAGGCAGG + Intronic
1027611861 7:80371032-80371054 GAAAGTAAAAAGAATGAGAAAGG + Intronic
1027976188 7:85159014-85159036 GATGGTAAAGAGAGTGATGTGGG - Intronic
1028389737 7:90301471-90301493 GATGGTAGAGAGTAGGAGGAGGG - Intronic
1028762291 7:94509782-94509804 GAGGCTAAAGAGGAGGAGGAAGG + Exonic
1029309633 7:99650706-99650728 GAAGGTAGAGAGGAGGAGGAGGG - Intronic
1029476136 7:100785959-100785981 GAAGAGAAAGAGAGTGAGGAGGG - Intronic
1029491406 7:100872467-100872489 GATGTCAAAGAGAATGAGAGAGG - Intronic
1029831377 7:103263145-103263167 GAGGGTGAAGGGTATGAGGAGGG + Intergenic
1029956335 7:104644279-104644301 TATGGGAAAGAGGATGTGGAGGG - Intronic
1029976155 7:104836169-104836191 GATGGGAAGGAGAATCAGGAAGG + Intronic
1029980681 7:104875863-104875885 GATTTTAATGAGAGTGAGGAGGG - Intronic
1029995135 7:105000530-105000552 GATGGAAAAAAGGAGGAGGATGG + Intergenic
1030495336 7:110291625-110291647 GATGATAAAGATAATGGTGATGG - Intergenic
1030742976 7:113131610-113131632 TAGGGTAGAGACAATGAGGATGG + Intergenic
1031289672 7:119917209-119917231 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
1031647740 7:124247460-124247482 GAGGGTAGAGGGAAGGAGGAGGG - Intergenic
1031728397 7:125266083-125266105 GATGATAAAGAAAAGAAGGAAGG - Intergenic
1033439605 7:141366956-141366978 GATGCTAAATTGAATGTGGAGGG + Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033843128 7:145399326-145399348 GATGGTGAGGAGAAAGAGGATGG + Intergenic
1033867146 7:145704707-145704729 GAAGGCAAATAGAAAGAGGATGG - Intergenic
1034087795 7:148335967-148335989 GAAGGGAAGGAGAATGAGGGAGG - Intronic
1035384767 7:158463478-158463500 GATGGTAATGGTAATGATGATGG - Intronic
1035639628 8:1174477-1174499 GATGGTAATGATGATGATGATGG - Intergenic
1035958513 8:4110718-4110740 GATGGTTGAGAGCATGAGAAAGG - Intronic
1036193308 8:6691489-6691511 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
1036505620 8:9352610-9352632 GAACGAGAAGAGAATGAGGATGG - Intergenic
1036828256 8:11997067-11997089 GAGGTGAAAGAGAATCAGGAGGG - Intergenic
1037201619 8:16260613-16260635 GATGATAATGAGGATGATGATGG + Intronic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1038007394 8:23444366-23444388 GATGGAGAGGAGAAGGAGGAAGG + Intronic
1038400003 8:27277387-27277409 GAGGGGAAAAAGAAAGAGGAGGG - Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1039063843 8:33592827-33592849 AATGGTGGAGAGATTGAGGAAGG - Intronic
1039182000 8:34877415-34877437 GCTGGAAATGAGAATGAGGGAGG + Intergenic
1039772180 8:40698577-40698599 GATGGTGAGGAGGATGAGGGTGG + Intronic
1040047646 8:42979726-42979748 AACGGTAAAGAGAATAACGAAGG - Intronic
1040419121 8:47222569-47222591 GATGGTGATGAGGCTGAGGATGG - Intergenic
1040419133 8:47222647-47222669 GATGGTGATGAGGCTGAGGATGG - Intergenic
1041094682 8:54338136-54338158 GGTGAAGAAGAGAATGAGGAGGG - Intergenic
1041767505 8:61434321-61434343 GATAGTAAAGGGAATGAACATGG + Intronic
1041856350 8:62460038-62460060 AATGGTTAAGAGAATGTGGTGGG + Intronic
1042124947 8:65528757-65528779 GATGTTAAAGAAAAATAGGAAGG + Intergenic
1042354485 8:67811377-67811399 CATGGTTATGAGAATAAGGAAGG + Intergenic
1042701421 8:71618961-71618983 GAGGCTGAAGAGAAAGAGGAGGG - Intergenic
1043132685 8:76481132-76481154 GAAGGAAAAGCGAATGAGGGAGG + Intergenic
1043610303 8:82054682-82054704 GATGGTAAAGAGATTAATGGTGG - Intergenic
1044073354 8:87789300-87789322 GCTGTTAAACAGAATGAAGAAGG - Intergenic
1044561712 8:93618569-93618591 GAAGGGAAAGAGACTGAGGTTGG + Intergenic
1044654027 8:94529075-94529097 GAAGGTGAAGAGGATGAAGAAGG - Exonic
1047108041 8:121756507-121756529 GGTGGTAAAGGCAGTGAGGAGGG + Intergenic
1047263695 8:123285674-123285696 GATGCCAAAAAGAATGAGTAGGG + Intergenic
1047414536 8:124653130-124653152 GATGGGAAAGAAACTGAGGAAGG + Intronic
1047785321 8:128148659-128148681 GGTGGGAAAGAGAAGGAGGGAGG + Intergenic
1047811837 8:128418800-128418822 GATGGTAATGGGAATGGGCAAGG + Intergenic
1047979418 8:130164993-130165015 GATGATAAACAGCATGAGAAAGG + Intronic
1048591795 8:135827156-135827178 GATGCTAAAGAGAAAAGGGAAGG - Intergenic
1048630435 8:136236458-136236480 GAGAGTGAAGAGAAAGAGGAGGG - Intergenic
1050515893 9:6444321-6444343 GATGGTAATCAAAAGGAGGAAGG + Intronic
1050920226 9:11191323-11191345 GATGGTAAAGACAATGGGAAAGG + Intergenic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1051919094 9:22243219-22243241 GATGGGAAGGATAATGAGGAAGG + Intergenic
1052070850 9:24080071-24080093 GCTGCAAGAGAGAATGAGGAAGG - Intergenic
1052121017 9:24716303-24716325 GATGGTAAAGATTATGTGCAAGG - Intergenic
1052689074 9:31792129-31792151 GATGGTGATGATAATGATGATGG - Intergenic
1052695066 9:31868007-31868029 GAAGGTGAAGAGAATGTGAAAGG - Intergenic
1052715805 9:32115581-32115603 GATGGTAAAAAGACTTCGGAAGG - Intergenic
1053474864 9:38375530-38375552 GATGGGAAAGAGACAAAGGAGGG + Intergenic
1054166332 9:61734428-61734450 GATGGTTGAAAGAATGAGGAAGG - Intergenic
1054360655 9:64112465-64112487 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1055256170 9:74373731-74373753 GATGGTAAAGGGAAGGAATAGGG - Intergenic
1055421006 9:76142233-76142255 CATGGAAAAGTGAATGAGTATGG - Intronic
1055910727 9:81347792-81347814 GATAGAAAATAGAATGAGGCTGG - Intergenic
1056090241 9:83198328-83198350 GACAGTAAAGAGAAAGAGAAAGG - Intergenic
1056545050 9:87606456-87606478 GAAGGGAAAGAGAGAGAGGAAGG - Intronic
1056965185 9:91159452-91159474 GAGAGGAAAGAGAAAGAGGAGGG + Intergenic
1056969682 9:91191813-91191835 TATGGGAAACCGAATGAGGATGG - Intergenic
1057267081 9:93624739-93624761 GATGGTAATGATAATGATGATGG + Intronic
1057811889 9:98263874-98263896 GAAGGCAAAGAGGGTGAGGAGGG - Intergenic
1058291514 9:103247021-103247043 GATAGTTAAGACAATGAGAATGG + Intergenic
1058789698 9:108430508-108430530 GATGGAAAAGAGAAAGACAAAGG + Intergenic
1059017789 9:110540148-110540170 GATGATAATGATAATGATGATGG - Intronic
1060260917 9:122072823-122072845 GATGTTACAGGGAAGGAGGAGGG - Intronic
1060299619 9:122367623-122367645 GTAGGTAAAGAGGAGGAGGAAGG + Intergenic
1060395935 9:123316579-123316601 GAAGGTGCAGAGAAAGAGGAAGG + Intergenic
1203693930 Un_GL000214v1:76895-76917 AATAGTAAAAAGAATGAGGTAGG - Intergenic
1203705613 Un_KI270742v1:40536-40558 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1203558382 Un_KI270744v1:25275-25297 AATAGTAAAAAGAATGAGGTAGG - Intergenic
1203642343 Un_KI270751v1:27168-27190 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1186749723 X:12609168-12609190 CAATGTAAAGACAATGAGGATGG - Intronic
1187044623 X:15634486-15634508 GATGGTAGTGATAATGATGATGG - Intronic
1187804220 X:23100574-23100596 GTTGGTGAAGAAAATGAGGGTGG - Intergenic
1188192124 X:27183930-27183952 GATGGTAAAGAGAGAGATGGCGG + Intergenic
1189547369 X:42055668-42055690 AATGCTAGAGAGGATGAGGAAGG - Intergenic
1190287859 X:48972400-48972422 GAGGGTAAAGGGAATGTAGAGGG + Intergenic
1190882936 X:54506298-54506320 GATGGTGATGACAATGGGGAGGG - Intergenic
1191650437 X:63531008-63531030 GAAGGTAGAGAAAGTGAGGAGGG + Intergenic
1191652335 X:63553038-63553060 GATGGTAATGAGGATGATAATGG + Intergenic
1192184490 X:68937586-68937608 GATGATGAAGGGAATGATGATGG + Intergenic
1192510209 X:71716887-71716909 GAGGGTAAAGAGGGAGAGGAGGG + Intronic
1192516488 X:71764666-71764688 GAGGGTAAAGAGGGAGAGGAGGG - Intronic
1192698327 X:73442523-73442545 TAGGGTAAAAAGAATGAGAAAGG - Intergenic
1192950408 X:76010454-76010476 TATGGTAATGATAATGATGATGG - Intergenic
1193407104 X:81114857-81114879 GATGGAAAAGAGAATGAAGATGG - Exonic
1193407114 X:81114971-81114993 GATGCAAAAGAGAAAGAAGATGG - Exonic
1193748273 X:85310639-85310661 GAAGGAAAGGAGAAAGAGGATGG + Intronic
1194140547 X:90203739-90203761 GAAGGTAAAGAGAAAGAAGGAGG - Intergenic
1194728666 X:97428656-97428678 GAGGGTTAAGAGAAGAAGGAGGG - Intronic
1195109911 X:101637689-101637711 GAGTCTAGAGAGAATGAGGAAGG - Intergenic
1196354859 X:114778898-114778920 GATAGTAAAGAGAATTAAAATGG - Intronic
1196528473 X:116755115-116755137 CAAAGTAAAGAGTATGAGGAAGG + Intergenic
1196834502 X:119801986-119802008 GAAGGGAAAGAGAAGAAGGAAGG - Intergenic
1198197015 X:134373404-134373426 GAGGGTAAAGAGAAAGAAGTCGG - Exonic
1198694286 X:139319458-139319480 GATGGCAAATAGAATGTGGGTGG + Intergenic
1198871537 X:141180930-141180952 AAGGGGAAAGAAAATGAGGAAGG - Intergenic
1199220137 X:145308335-145308357 GATGGTCAAGAGATTCGGGAGGG - Intergenic
1199575673 X:149311703-149311725 GATGGTGAAGCCAATGATGAAGG - Intergenic
1200486306 Y:3772844-3772866 GAAGGTAAAGAGAAAGAAGGAGG - Intergenic
1200894998 Y:8366174-8366196 GATGGTAAAGTCAGTGATGAGGG - Intergenic