ID: 934656965

View in Genome Browser
Species Human (GRCh38)
Location 2:96121432-96121454
Sequence TGGGCTGGAAGCAGAACAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 354}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934656965_934656969 -3 Left 934656965 2:96121432-96121454 CCGGCTGTTCTGCTTCCAGCCCA 0: 1
1: 0
2: 2
3: 35
4: 354
Right 934656969 2:96121452-96121474 CCATTCTCCAGAATGCATCGAGG 0: 1
1: 0
2: 0
3: 7
4: 98
934656965_934656971 18 Left 934656965 2:96121432-96121454 CCGGCTGTTCTGCTTCCAGCCCA 0: 1
1: 0
2: 2
3: 35
4: 354
Right 934656971 2:96121473-96121495 GGACGTTTTAAACCTTAAGTCGG 0: 1
1: 0
2: 0
3: 1
4: 55
934656965_934656972 24 Left 934656965 2:96121432-96121454 CCGGCTGTTCTGCTTCCAGCCCA 0: 1
1: 0
2: 2
3: 35
4: 354
Right 934656972 2:96121479-96121501 TTTAAACCTTAAGTCGGATGTGG 0: 1
1: 0
2: 0
3: 9
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934656965 Original CRISPR TGGGCTGGAAGCAGAACAGC CGG (reversed) Intergenic
900932244 1:5744525-5744547 TGAGCTGGAAGCAGAGCTGGGGG - Intergenic
900959891 1:5912185-5912207 TGGGATGGGAGGAGACCAGCCGG + Intronic
901754852 1:11435288-11435310 TGGGGTGGAACCAGAACACAGGG + Intergenic
901929953 1:12590808-12590830 TGCACTGGAAGCAGAAGGGCTGG - Intronic
902099312 1:13972734-13972756 TGGACTGGAATCAAAACATCTGG + Intergenic
902143730 1:14379133-14379155 TGGGCCAGAAGCAGACCAACTGG + Intergenic
902211670 1:14909001-14909023 TGGACTGGAGCCAGAACACCTGG + Intronic
902449642 1:16488741-16488763 TAGGGTTGAAGCAGAGCAGCAGG - Intergenic
902504840 1:16932601-16932623 TAGGGTTGAAGCAGAGCAGCAGG + Intronic
902581343 1:17409641-17409663 TGGGCTGGAGGCAGGTCCGCAGG - Intronic
902816288 1:18918499-18918521 TGGGCTGCAGGGAGGACAGCAGG + Exonic
903021841 1:20400350-20400372 TGGGTTGGAAGGAGAAAACCAGG - Intergenic
903049307 1:20589097-20589119 CGGGCAGGCAGCAGAGCAGCGGG - Exonic
903187145 1:21635122-21635144 TGGGCAGGGGGCAGAGCAGCTGG - Intronic
903238745 1:21968437-21968459 TGGGATGGGAGCAGAGAAGCGGG - Intergenic
903990327 1:27263214-27263236 GGGCCTGGAAGCAGAGCTGCAGG + Exonic
904452029 1:30619483-30619505 TGGGGTGGGAGCAGAAGACCTGG - Intergenic
904864195 1:33563680-33563702 TGGCCTGGAATCAGAGAAGCTGG - Intronic
905123806 1:35702913-35702935 TGGGCAGGAAGAAGGACAGAAGG + Intergenic
905227151 1:36486774-36486796 GGGGCGGGAGGCAGGACAGCTGG - Intergenic
905900838 1:41581193-41581215 TGGCCTGGGTGCAGAACAGTAGG + Exonic
906077791 1:43064881-43064903 TGGGCAGGAAGCAGACAAGTTGG - Intergenic
906104927 1:43285954-43285976 TGGGCTGGAACCAGAGCGGGTGG + Intergenic
906165003 1:43679558-43679580 TGGCATGGAAACTGAACAGCAGG - Intronic
906197831 1:43939991-43940013 GGGTCTGGAAGCTGGACAGCAGG - Intergenic
906638268 1:47424888-47424910 TGGGCTGGAGGCAGAAAACCTGG + Intergenic
906686991 1:47769281-47769303 TGGGCTGGCTTCAGGACAGCAGG + Intronic
907050511 1:51326912-51326934 TGGGCTGGATGGAGCAGAGCTGG + Intronic
907490303 1:54805149-54805171 TGGGCTGGAAGCAGGGCCTCTGG + Intergenic
907875696 1:58485259-58485281 TGGCCTGGAAGTAAAAAAGCTGG + Intronic
908521486 1:64947507-64947529 TGAACAGGAAGCAGAATAGCAGG + Intronic
910495001 1:87816889-87816911 TGGGGTTGAAGCAGCAAAGCTGG + Intergenic
911039984 1:93583694-93583716 TGGGCTTGAATCAGAAAACCTGG + Intronic
911639535 1:100272453-100272475 TAGGATGGATACAGAACAGCTGG - Intronic
912249010 1:107991674-107991696 TGGGGTGCAAGCATAGCAGCAGG - Intergenic
912520876 1:110243784-110243806 CAGGCTGGAAATAGAACAGCTGG + Intronic
915543865 1:156584940-156584962 AAGGCAGGAAGCAGCACAGCAGG + Exonic
916337467 1:163689604-163689626 TGGTGAGGATGCAGAACAGCAGG + Intergenic
916392433 1:164345080-164345102 TGGGCTGGAACAGAAACAGCAGG - Intergenic
916574013 1:166051214-166051236 TCTGCTGGAAGCAGAACAGATGG + Intergenic
918378719 1:183933958-183933980 TGGATTGGAAGCAACACAGCTGG + Intronic
920435558 1:205944529-205944551 TGGGCTGGAATCAGTGCAGGGGG + Intergenic
921488844 1:215749199-215749221 AGGCCTGGAAGCAGAACAGTAGG - Intronic
921896895 1:220411251-220411273 TGGGCTAAGAGCAGAACTGCTGG + Intergenic
922219959 1:223550861-223550883 TGGGCTGGCAGCACCACAGGTGG - Intronic
922297894 1:224268064-224268086 TGGTCTGGAAGCACGCCAGCAGG - Exonic
1063111589 10:3042719-3042741 ACAGCTGGCAGCAGAACAGCAGG + Intergenic
1063801004 10:9578058-9578080 TGAGTTGTAAGCAGAACAGGAGG + Intergenic
1065974957 10:30833906-30833928 TGGGCTGGGAGCGCAAAAGCGGG + Intronic
1066258405 10:33704302-33704324 TAGGCAGGAAGGAGAAAAGCAGG - Intergenic
1067019980 10:42786859-42786881 TGGGCCTGCAGCTGAACAGCAGG + Intronic
1067451376 10:46384129-46384151 AGGGCTGGAAGGAGGAAAGCAGG + Intronic
1067585866 10:47475627-47475649 AGGGCTGGAAGGAGGAAAGCAGG - Intronic
1067745558 10:48933139-48933161 TGTGGTGGAAGCAGAGCAGATGG + Intronic
1067828933 10:49598789-49598811 GTGGCTGGAAGGAGACCAGCAGG - Intergenic
1069854685 10:71433531-71433553 TGGGCTGGAAGCAGAAGTGTGGG - Intronic
1071518655 10:86315572-86315594 GGGGCAGGAAGCAGATCAGGTGG - Intronic
1072543222 10:96414171-96414193 GGGTCTGGAAGCAGAAGAGGAGG - Intronic
1073057211 10:100710360-100710382 TGGGCTGGCAGCAGGAGCGCGGG - Intergenic
1073498273 10:103913839-103913861 TGGGCTGCATGTGGAACAGCAGG - Intronic
1074268330 10:111927725-111927747 TGGGCTGGAAGGACAACAGAAGG - Intergenic
1074396833 10:113104970-113104992 TTGGCAGGAAGCAGAAAAGAAGG + Intronic
1074869370 10:117564885-117564907 TGGCCTGGCAGCCCAACAGCAGG + Intergenic
1074923967 10:118047429-118047451 TGGGCTGGCATCAGAAGACCTGG + Intergenic
1075654763 10:124153454-124153476 TGGGCTGGAAGCACGTCAGCAGG + Intergenic
1075710403 10:124527609-124527631 GGGGCTGAAACCAGAGCAGCAGG + Intronic
1075825811 10:125356303-125356325 TGGTCATAAAGCAGAACAGCGGG - Intergenic
1076053214 10:127351655-127351677 TTGCCTGGAAGCAGAACCCCGGG - Intronic
1076908905 10:133377841-133377863 TGGGCCTGAAGCAGAGCCGCTGG - Intergenic
1077614168 11:3663180-3663202 TGGGAAGGAGGCAGAACAGGAGG + Intronic
1078143691 11:8709085-8709107 TGGGGAGGGAGCAGAGCAGCAGG + Intronic
1078367222 11:10716791-10716813 GGGCCAGGAGGCAGAACAGCAGG + Intergenic
1079078681 11:17398812-17398834 TGGGCAGGAAGCAGGATAGAGGG - Intronic
1079087141 11:17454555-17454577 TGGGCTGGAAGCAGAAAAATGGG + Intronic
1079394499 11:20050208-20050230 TGGGAAGGAAGCTGAAAAGCAGG - Intronic
1079669918 11:23155763-23155785 TGGGTTAGTAGCAGAACAACTGG + Intergenic
1079937675 11:26637746-26637768 TGGGCTGGAACAGGAAAAGCAGG + Intronic
1080384035 11:31799968-31799990 AGGGCTGGAGGAAGAAGAGCGGG - Intronic
1081602734 11:44506456-44506478 TGGGCTAGGAGCAGGAAAGCAGG + Intergenic
1081745054 11:45467263-45467285 TGGGCAGAAAGCAGAGCTGCAGG + Intergenic
1081748704 11:45491543-45491565 TGGGGTGTTTGCAGAACAGCAGG + Intergenic
1082006225 11:47420645-47420667 TGGGCTGGAAGCCATCCAGCTGG + Exonic
1082925779 11:58545350-58545372 TTGCCTGAAAGCAGAACAACAGG - Intronic
1083381613 11:62273931-62273953 TGAGGTAGAAGCAGAACAGGTGG - Intergenic
1084958411 11:72703524-72703546 TGGGCTGGGAGCAGGACGCCTGG + Intronic
1086558023 11:88134723-88134745 AAGGTTGGAAGCAGATCAGCTGG - Intronic
1088415879 11:109588721-109588743 GGGTCTGGAAGAAGAACAACAGG + Intergenic
1089300372 11:117495196-117495218 GGGGCTGGGAGCATAACAGGGGG - Intronic
1090124362 11:124070228-124070250 AGGGCTGGGAGGAGAACGGCGGG - Intergenic
1090669624 11:128937256-128937278 CGGGGTGGACGCAGAAGAGCAGG + Intronic
1091034279 11:132219124-132219146 GGGGATGGAAGGAGAACAGATGG - Intronic
1091092571 11:132786098-132786120 TGGTCTGTAAGGAGAGCAGCTGG - Intronic
1092030886 12:5283846-5283868 TGGACTGGAAGTAGGAAAGCAGG - Intergenic
1092106792 12:5927073-5927095 GGGACTTGAAGCAGAGCAGCTGG - Intronic
1092724771 12:11474721-11474743 GGGGATGGAGGCAGAGCAGCAGG - Intronic
1094377383 12:29804283-29804305 GGGGATGGAAGCAGAGCAGGAGG - Intergenic
1096537823 12:52286669-52286691 TGGGCTGGCATCACAACAGGAGG - Intronic
1096655315 12:53087014-53087036 TTGCCTGGAAGCAGCACAGAAGG - Intergenic
1096684181 12:53276998-53277020 AGGGCTAGCTGCAGAACAGCTGG - Intronic
1098833566 12:75392298-75392320 TGTGGTGAAAACAGAACAGCTGG - Intronic
1101984018 12:109431625-109431647 AAGGCTGGAAGCAGCACAACCGG - Intronic
1104067390 12:125317021-125317043 AGGGCTGGAAGCAGAATGGGGGG + Intronic
1104758902 12:131285536-131285558 TGAGATGGAAGCAGCACAGGAGG - Intergenic
1104821708 12:131680960-131680982 TGAGATGGAAGCAGCACAGGAGG + Intergenic
1105267989 13:18838216-18838238 TGGGCTGGAGGAAGCAGAGCTGG - Intergenic
1105634253 13:22202033-22202055 TGGGCTGGAGCCAGAACTGATGG + Intergenic
1106256056 13:28022891-28022913 TGGGCTGGCAGCAGTCCTGCAGG - Intronic
1107285706 13:38788709-38788731 TTGGATGGAAGCAGTAGAGCAGG + Intronic
1108456544 13:50620743-50620765 TGGGCTGGATACATAGCAGCTGG + Intronic
1108505979 13:51112805-51112827 TGGGCTGGAAGCTGGACAATTGG - Intergenic
1109273445 13:60279501-60279523 TGGGCTGGGAGCAGGGTAGCAGG + Intergenic
1110615895 13:77542113-77542135 TGGGCTGTAAGAAAAAGAGCTGG + Intronic
1112428439 13:99326721-99326743 TGGGCCTGGAGCAGAACACCTGG - Intronic
1112754938 13:102621769-102621791 TGGGCTGGGGGAAGAACAGAGGG + Intronic
1113562902 13:111298039-111298061 TGGGCTCAAAGCAGGACAACTGG + Intronic
1113613603 13:111665413-111665435 TGGGACGGAAGCAGAACCCCAGG + Intronic
1115192607 14:30761575-30761597 TTGGCTGAAATCAGAACAGAGGG + Intergenic
1115447412 14:33507364-33507386 TGTGCAGGAAGTAAAACAGCAGG + Intronic
1115879749 14:37902076-37902098 TGGGTTGTAAGGAGAACGGCAGG - Intronic
1116216671 14:42025414-42025436 TGGACTGCACCCAGAACAGCAGG - Intergenic
1117361792 14:54982539-54982561 TGAGTTGGAAGCAGAATAGGTGG - Intronic
1117630257 14:57683870-57683892 TGGGGTGGGAGCTGAACAGAAGG + Intronic
1118108496 14:62689013-62689035 TGAGCTGGGAGCAGGAGAGCAGG - Intergenic
1118473733 14:66098570-66098592 TGGGCTGGAAGCAGATCAAGTGG + Intergenic
1119266455 14:73265531-73265553 GGGGCTGGAGGCAGAATAGGAGG - Intronic
1120997485 14:90427675-90427697 TGGGGTAGAATCAGAACACCTGG - Intergenic
1121106548 14:91283586-91283608 TGGCCTAGAAGCAGGGCAGCAGG + Intronic
1121158974 14:91716774-91716796 TGGCCTGGATGCAGATCACCTGG + Intronic
1122329365 14:100902400-100902422 TGGGCTTTTAGCAGAACAGCAGG - Intergenic
1122570207 14:102693045-102693067 TGGGCTGGGAGCAGAAGCTCAGG - Intronic
1124621265 15:31275429-31275451 TGGGCTGGCAGCAGAGGGGCTGG + Intergenic
1124677495 15:31698371-31698393 TGAACTGGAAGGAGAAGAGCTGG - Intronic
1125724613 15:41861952-41861974 GGGGCTGGAAGCAGCCCAGCAGG + Intronic
1125842329 15:42814811-42814833 TGTGCTGGGAGCAGAAAAGAGGG + Intronic
1128659894 15:69491178-69491200 AGGCCTGGAGGCTGAACAGCTGG + Intergenic
1132328008 15:100988109-100988131 TCAGCTGGAAACAGGACAGCTGG + Intronic
1132900311 16:2250545-2250567 TGTCCTGGAAGCAGAACTGCTGG + Intronic
1134136215 16:11677994-11678016 TGGGGTGGAAGAGGGACAGCCGG + Exonic
1134812094 16:17176460-17176482 TGGCCAGTAAACAGAACAGCTGG + Intronic
1136098436 16:27975348-27975370 AGGGGTGGATGGAGAACAGCTGG + Intronic
1136748850 16:32615278-32615300 TGGGCTGGGGTCAGAAGAGCTGG + Intergenic
1138507203 16:57484365-57484387 TGGGGTGGGGGCAGAGCAGCAGG - Intronic
1138587176 16:57978130-57978152 TGGGCAGGGAGCAGCAGAGCTGG - Intronic
1138714548 16:59006026-59006048 TGGGATGGAAGCACATCAGCTGG + Intergenic
1141647696 16:85376381-85376403 TGGGCCGGGAGCAGAAGGGCAGG - Intergenic
1141897249 16:86965944-86965966 TGGTCTGAGAGCAGAACCGCCGG + Intergenic
1142120813 16:88385911-88385933 TGGGCTGCAACCACAGCAGCTGG - Intergenic
1203050983 16_KI270728v1_random:874492-874514 TGGGCTGGGGTCAGAAGAGCTGG + Intergenic
1143172219 17:4936946-4936968 TGGGCTGGAGGCAGTGCAGGTGG - Intergenic
1143305679 17:5944928-5944950 TGGGATGGCAGCCGAGCAGCTGG - Intronic
1144429106 17:15174206-15174228 TGGGCTGCAAGCTGAAGAGAAGG - Intergenic
1144503110 17:15806793-15806815 TGGCCTGGAACCTCAACAGCAGG - Intergenic
1144646995 17:16981873-16981895 TGGGCAGAAAGAAGAACAACAGG - Intergenic
1144998853 17:19289467-19289489 AGGGCTGGGAGCAGAGCAGCTGG + Intronic
1145165291 17:20609499-20609521 TGGCCTGGAACCTCAACAGCAGG - Intergenic
1145974878 17:28978148-28978170 TGGGCGGGAAGCAGAACAGAAGG + Intronic
1147769625 17:42858551-42858573 TGGGCTTGGGGCAGAACAGAAGG - Intergenic
1147915582 17:43883358-43883380 GGGGGTGGAAGCAGAACAGGTGG + Intronic
1148059858 17:44829480-44829502 AGGGCTGGAAGCGGGAAAGCGGG - Intronic
1148079961 17:44962240-44962262 TGGGCTGGAGGCAGCACTGCAGG + Intronic
1148800177 17:50220275-50220297 TGGACTTTGAGCAGAACAGCTGG - Intergenic
1149183823 17:53973690-53973712 TTGGCTGGAAGCAGAGAATCTGG - Intergenic
1149822680 17:59794626-59794648 TGGGCTGGAATAAGAAAAGGAGG + Intronic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1150558128 17:66272090-66272112 TTGCCTGAAAGCAGAACAACAGG - Intergenic
1151834217 17:76572819-76572841 GGAGATGGAAGCAGAACAGACGG - Intronic
1152403350 17:80082722-80082744 TTGGCTGGTAGCAGCACGGCTGG - Intronic
1155334058 18:24747096-24747118 TGTGGTGGAAGCAAAAAAGCTGG - Intergenic
1156478839 18:37423562-37423584 GGGCCTGGAAGAAGAACACCAGG - Intronic
1158863123 18:61612502-61612524 TGGAGTTGAAGCAGAACAGTTGG - Intergenic
1160546830 18:79663372-79663394 TGGGCAGGAAGCATTGCAGCAGG - Intergenic
1160749730 19:728135-728157 CGGGATGGATGCAGAGCAGCTGG + Intronic
1160847303 19:1172275-1172297 TGGGTGGGATGGAGAACAGCAGG - Intronic
1161390364 19:4017346-4017368 TGGGCAGGAAGCAGAGCAGGAGG - Intronic
1162041838 19:7975472-7975494 CAGGCTAGAATCAGAACAGCTGG + Intronic
1162132618 19:8536552-8536574 TGGGCCTGAAGGAGAACATCAGG - Exonic
1162300974 19:9844788-9844810 GGGGCTCGAAGCAGAAATGCTGG - Intronic
1162443452 19:10707578-10707600 TGGGCTGGACGCAGATCTCCGGG + Exonic
1162585229 19:11554162-11554184 GGGGCAGGATGGAGAACAGCGGG + Intronic
1163138947 19:15333039-15333061 TGGGTTGGAAGAAGATCAACAGG - Intergenic
1163372474 19:16909066-16909088 TGTGCTGGAATCAGATGAGCTGG - Intronic
1163394102 19:17049041-17049063 TGGGGTGGAAGCTGGAGAGCTGG + Intergenic
1163849781 19:19656414-19656436 TGGGCTGGGAGCAGTCCAGAGGG - Intronic
1164463719 19:28470107-28470129 GGTGCTGGAGGCAGAACAGATGG + Intergenic
1165757901 19:38304781-38304803 TGGGCTGGAAGCGAGACAGGGGG - Intronic
1166388091 19:42393150-42393172 GGGGCTGGGAGCAGAACAGGAGG + Intergenic
1167455391 19:49594981-49595003 TGGGCTGGACCGAGACCAGCTGG - Exonic
1167597346 19:50434808-50434830 TGGGCTGGAAACTGGACACCTGG - Intronic
1168004454 19:53475477-53475499 TCGACTGGGAGCAGAATAGCCGG + Intronic
925038966 2:715410-715432 TGGGATGGAAGCAGATCTGGTGG - Intergenic
927696850 2:25244980-25245002 GGGGATGGGAGCAGAGCAGCGGG - Intronic
928072811 2:28234331-28234353 GGGCCTGGCAGCAGAACACCTGG + Intronic
929530911 2:42751915-42751937 TGGGCTGTTAGCAGAACACTGGG + Intronic
931627557 2:64270685-64270707 TCAGCTGGAAGCATAACAGGGGG + Intergenic
932312945 2:70758838-70758860 TGGGCTGGAAGCAGGGAAGAAGG + Intronic
933850313 2:86361420-86361442 GGAGGTGGAAGCAGAACAGGTGG - Intergenic
934656965 2:96121432-96121454 TGGGCTGGAAGCAGAACAGCCGG - Intergenic
936671598 2:114662739-114662761 TGGGCTGCAAGCAGAACCCCAGG - Intronic
937354113 2:121187401-121187423 GTGGCTGGAATCAGAACACCTGG + Intergenic
938375914 2:130806572-130806594 TGGTGAGGAAGCAGAACAGTAGG - Intergenic
938767013 2:134466902-134466924 GGAGCTTGAAGCAGAAGAGCTGG - Intronic
939177355 2:138764335-138764357 TGGGCTGGAACCAAAGCACCAGG - Intronic
943469794 2:188279420-188279442 TGGGCTGAAGGCAGAACAATGGG - Intergenic
944540685 2:200750644-200750666 AGAGCTGGGAGCTGAACAGCTGG - Intergenic
946803210 2:223443011-223443033 CAGACTGGAAGCAGAACAGCAGG + Intergenic
947103297 2:226644568-226644590 TGGGCTGGAGGCATAACTTCGGG - Intergenic
947263797 2:228253857-228253879 TGGCCTTTAAGCATAACAGCTGG + Intergenic
948070373 2:235116465-235116487 GGGGCTGGAAGCAGAGGAGCAGG - Intergenic
948145537 2:235705439-235705461 TTGGAAGGAAGCAGGACAGCTGG + Intronic
948599069 2:239097749-239097771 CGGGCAGCAAGCAGGACAGCAGG - Intronic
1168794588 20:603017-603039 TGGGGTAGAGGCAGAACAGAGGG + Intergenic
1168829604 20:838384-838406 TGGGCTGGGTCCAGAACAGCCGG + Intronic
1169206274 20:3742024-3742046 GAGGCTGGAAGCAGGAAAGCAGG + Intronic
1169263641 20:4154871-4154893 TGGGCTGGGGGCAGGACAGAGGG + Intronic
1169297033 20:4408857-4408879 TGGTGTGAAGGCAGAACAGCAGG + Intergenic
1170353671 20:15469561-15469583 GGGGCTGGAAGCAGAGGAGGGGG + Intronic
1171174422 20:23040819-23040841 TGGGCTGGAAGTGGGAGAGCCGG - Intergenic
1171208327 20:23298369-23298391 TGAGCAGGAAGCAGCTCAGCAGG + Intergenic
1171271490 20:23821898-23821920 GGGGCTGAGAGCAGAACAGCAGG - Intergenic
1172448355 20:35004729-35004751 TTGCCTGGTAGCAGGACAGCTGG - Intronic
1172848767 20:37945396-37945418 TGGGGTGGAGGCAGGAGAGCAGG + Intergenic
1173243894 20:41320834-41320856 TGGGCTGGAAGCAGAGTAAGGGG + Intergenic
1174284241 20:49461089-49461111 TGGGCTGGCAGCAGAACGTGGGG - Intronic
1174313364 20:49677149-49677171 TGGGCTGGAAGGGGAACCACCGG + Intronic
1174442675 20:50568417-50568439 TGGTGTGGGAGCAGAAAAGCAGG + Exonic
1174667167 20:52270473-52270495 TGGGTTGTAACCAGAACTGCTGG + Intergenic
1174967018 20:55227509-55227531 GTGGCAGGTAGCAGAACAGCTGG - Intergenic
1177233782 21:18359196-18359218 GGGGCTGGAAGCTGAAAAGAGGG - Intronic
1178274109 21:31220752-31220774 AGGGCTGGCAGAAGAACTGCTGG + Intronic
1178546021 21:33493648-33493670 GGGCCTGGAAGCAGAAGAGGGGG - Intergenic
1179613010 21:42564634-42564656 CGGGGAGGAAGCAGAACTGCAGG - Intronic
1180757117 22:18169852-18169874 TGGGCTGGAAGAAGCAGTGCAGG - Exonic
1181074661 22:20367613-20367635 TGGGCTGGAAGAAGCAGTGCAGG + Exonic
1181859281 22:25805687-25805709 TGGGCAGGGACCAGACCAGCTGG - Intronic
1182468138 22:30530878-30530900 GGGGCTGGAAGCAGAAGGGTAGG + Intronic
1182518518 22:30872193-30872215 TGGGCTGTAAGGAGGACAGTGGG - Intronic
1183294622 22:37022290-37022312 TGGGGTGGCAGCAGAAGAGGTGG - Intronic
1183785882 22:40028855-40028877 TAGGCTGGAAGAAGGAAAGCTGG - Intronic
1184429071 22:44430690-44430712 TGGGCTGGTAGGAGCACATCTGG - Intergenic
1184794172 22:46721946-46721968 TGGGCTGGCAGCAGAGCTGTGGG + Intronic
949471546 3:4401807-4401829 TGGGATGGCAGCAGTTCAGCAGG - Intronic
949792574 3:7809381-7809403 TGGGGAGGAATCAGAAAAGCAGG - Intergenic
949997036 3:9626299-9626321 TGTGCTGGAAGCAGAAGCTCAGG + Intergenic
950004126 3:9680540-9680562 TGGGCTGCAGGAAGATCAGCTGG - Intronic
950629927 3:14275601-14275623 TGGGCTAGAATCAGAAGACCTGG + Intergenic
950905826 3:16537012-16537034 TGGGCTGGAATCAGACCCCCTGG + Intergenic
953529502 3:43727361-43727383 TGTACTGGAAGCAGAACTCCTGG + Intronic
953651324 3:44807566-44807588 TTGGCTGGAAGAACAACAGAAGG - Intronic
953693873 3:45142662-45142684 TGTTCTGGAAGCAGAATTGCTGG - Intronic
954098938 3:48354766-48354788 TGGGCTGACAGCAGAACTGGGGG - Intergenic
954258056 3:49419841-49419863 TGGGCTGGACGCTGCAGAGCTGG + Intronic
955052543 3:55426474-55426496 TGGGCTGGGAGCAGAAGACGGGG - Intergenic
960823569 3:121759290-121759312 TGGGCAGTGAGCAGAACACCAGG - Intergenic
960950017 3:122993167-122993189 TGGTCTGGCCGCAGAAAAGCAGG + Intronic
961443741 3:126968376-126968398 TGGCCTGGGGGCTGAACAGCTGG - Intergenic
961470763 3:127110127-127110149 TGGGCTGGAGCCAGAGCAGGGGG + Intergenic
961531387 3:127542396-127542418 TGGGCTGGAAGGAAACCAGGAGG + Intergenic
961593702 3:127999897-127999919 TGAGCTGGACAAAGAACAGCTGG + Intergenic
961638636 3:128350536-128350558 TGGGCTGGGACCAGAATACCAGG - Intronic
962184672 3:133245424-133245446 GGGGCTGTAATCTGAACAGCAGG - Intronic
962963319 3:140331297-140331319 TGGGCTGGCAGCTGATCAGATGG + Intronic
964473239 3:157076235-157076257 TGGGCTGGCAGCAGATCCTCAGG - Intergenic
965088165 3:164126236-164126258 TGGGCTGAAATCAGAGCATCAGG - Intergenic
966235420 3:177696214-177696236 TGGGCTGGATGAAGAAAATCTGG - Intergenic
967309973 3:188096494-188096516 TGAGCTGGAGGCTGAACAACTGG - Intergenic
967977696 3:195044624-195044646 TGGGCTGAAGGCAGGACACCAGG - Intergenic
968648045 4:1749576-1749598 AGGGCTGGAGGCAGCACACCAGG + Intergenic
968708500 4:2095353-2095375 TGGGCTGGGAGCAGAGCAGTAGG - Intronic
969238980 4:5887559-5887581 GGTGGTGGAGGCAGAACAGCCGG - Intronic
969290359 4:6235175-6235197 TGGGCTGGATGTGGAAGAGCAGG - Intergenic
969298369 4:6282639-6282661 TGGGCTGGGAGCAGGGCAGCTGG - Intronic
969301711 4:6300932-6300954 TGGGCTCGAAGCGCAGCAGCAGG - Exonic
971184241 4:24358430-24358452 TGGGCTGGGGCCAGAACACCTGG - Intergenic
972640094 4:40917365-40917387 CGGGCTGGAAGCAGCAGAGACGG + Intronic
972978226 4:44663685-44663707 TGGGCTGGCAGGCAAACAGCAGG - Intronic
974425704 4:61740807-61740829 TGTTTGGGAAGCAGAACAGCAGG - Intronic
975163795 4:71153870-71153892 TGGGCTGGAAGCACATAATCAGG + Intergenic
979652195 4:123148412-123148434 TGACTTGGAAGCAGATCAGCTGG + Intronic
980888277 4:138786466-138786488 TGGGCTTGAGGCAGAACACAAGG - Intergenic
982275137 4:153630512-153630534 TGGCCTGCAAGGAGAACATCTGG + Intronic
983715073 4:170772230-170772252 TGAGGAGGAAGAAGAACAGCAGG + Intergenic
984193460 4:176631544-176631566 TGAGCTGCATGCAGAACAGCAGG + Intergenic
984919110 4:184748387-184748409 GGCGCTGGCAGCAGCACAGCAGG + Intergenic
985107063 4:186509916-186509938 TGGGCTGGAAGGAGTATATCGGG - Intronic
987008951 5:13740290-13740312 TGGGCTGGGAGTAGACCAGGGGG - Intronic
988390781 5:30627112-30627134 TGGAATAGAAGAAGAACAGCTGG - Intergenic
988821770 5:34893534-34893556 TGATTTGGTAGCAGAACAGCTGG + Intronic
988842345 5:35095200-35095222 AGGGCGGGAAGAGGAACAGCAGG + Intronic
990241309 5:53819256-53819278 GGGGCTTGGAGCAGAAAAGCAGG - Intergenic
990834240 5:59997950-59997972 TTGCCTGGAATGAGAACAGCAGG + Intronic
992881606 5:81115894-81115916 TGCTCTGGAAGCTGAAGAGCAGG + Intronic
992884257 5:81142197-81142219 TGGGGTAGAATAAGAACAGCCGG + Intronic
992997388 5:82346813-82346835 TGGGCGGGCAGCAGAAAAGGTGG - Intronic
997248715 5:132372464-132372486 TGGGATGGAGGCAGCAAAGCAGG - Intronic
997264216 5:132485766-132485788 TGGGCTGGAACTGGAACTGCAGG - Intronic
997880623 5:137586496-137586518 TGGGCAGGAAGGAGATCAGCAGG + Intronic
998037357 5:138928195-138928217 GGGGCAGCAGGCAGAACAGCTGG - Intronic
1000202040 5:159020539-159020561 TGAGCTGGACACAGAACTGCAGG - Intronic
1000634019 5:163622907-163622929 TGCAATGAAAGCAGAACAGCAGG + Intergenic
1001990735 5:176113655-176113677 TGGGCTGGGGTCAGAAGAGCTGG + Intronic
1002226138 5:177724485-177724507 TGGGCTGGGGTCAGAAGAGCTGG - Intronic
1002267711 5:178046728-178046750 TGGGCTGGGGTCAGAAGAGCTGG + Intronic
1002283900 5:178149649-178149671 TGGGCTGGCAGCAGGACGACTGG - Exonic
1002603329 5:180367847-180367869 TGTTCTGGAAGCAGAAAGGCTGG + Intergenic
1003161486 6:3638225-3638247 TGGGCTGGGAGCAGGGCAGGGGG + Intergenic
1005389411 6:25318201-25318223 TGGGTTGGAAGGGGAGCAGCAGG + Intronic
1005976250 6:30802129-30802151 TGTGCTGGCAACAGAACAGACGG - Intergenic
1006144923 6:31953120-31953142 AGGGCTGGGAGCAGCACCGCAGG - Intronic
1006364454 6:33607248-33607270 TTGGCTGGGAGCAGGACAGGTGG + Intergenic
1006557782 6:34883442-34883464 AGATCTGGAAGCAGAAGAGCTGG - Intronic
1006832917 6:36979644-36979666 TGGGCTGGAAGGAGAGGAGGAGG + Intronic
1007139128 6:39554171-39554193 TGTGGGGGAAGCAGAACATCTGG + Intronic
1008673157 6:53794129-53794151 TGGGGTTGTAGCAGAAAAGCAGG + Intergenic
1009481953 6:64170066-64170088 TGGGCTGCAATGCGAACAGCTGG + Intronic
1011272471 6:85593613-85593635 GCAGCAGGAAGCAGAACAGCGGG + Exonic
1013322573 6:109009377-109009399 TGGGCTGCAAGCAGTGCGGCGGG - Intronic
1014543069 6:122699683-122699705 TGGGGTGGAGGCAGAAGAGTCGG + Intronic
1015673809 6:135722635-135722657 TGGGCTGGATACAGAACATTAGG + Intergenic
1015686558 6:135869893-135869915 TGGGATGGAAGGAGATGAGCAGG + Intronic
1017813078 6:157998121-157998143 TCCCCTGGAAGCAGAGCAGCAGG - Intronic
1019572898 7:1721523-1721545 TCGGCTGGAAGAAGAACAGCTGG + Intronic
1019735820 7:2649332-2649354 TGAGCTGGAAGCAGGACTGGAGG - Intronic
1019786150 7:2978763-2978785 TGGGCTGGAAACAGGTGAGCCGG - Intronic
1020279670 7:6643875-6643897 AAGGCTGGAAGCAGACCAGCGGG + Exonic
1020846714 7:13294392-13294414 TGGGTGGAAAGCAGAACAGGAGG + Intergenic
1021536394 7:21709426-21709448 TGGGAGGGAAGGAGAGCAGCAGG + Intronic
1021542063 7:21770742-21770764 TGGGCAGGAAGAAGTACAGGAGG + Intronic
1021821175 7:24498952-24498974 TGGGCTGGAGGGAGAACCACAGG - Intergenic
1022357682 7:29631083-29631105 TGGGCAAGGAGCAGAACAGATGG + Intergenic
1022426675 7:30275889-30275911 GGGGATGGAACCAGTACAGCAGG - Intergenic
1022530890 7:31066230-31066252 TGGGTTGGGAGCAGGACACCTGG - Intronic
1023267736 7:38425620-38425642 AGGGCAGGAAGCAGAAGAGGGGG + Intronic
1023871355 7:44264605-44264627 TGGGCTTCCAGCAAAACAGCGGG - Intronic
1024281503 7:47723050-47723072 TGGGTTTGAAGCATAACAGGAGG - Intronic
1024525454 7:50345114-50345136 TGGGCTGGGAGAAGACCAGAGGG - Intronic
1028718752 7:94004569-94004591 CGGGCTGCGAGCGGAACAGCGGG - Intergenic
1029747618 7:102525237-102525259 TGGGCTTGAAGGAGAAGAGCTGG + Intergenic
1029765569 7:102624327-102624349 TGGGCTTGAAGGAGAAGAGCTGG + Exonic
1030153723 7:106430882-106430904 TGTGCTAAAAGCAGGACAGCAGG - Intergenic
1030979203 7:116166539-116166561 TGGGCAAGAATCAGAACAGCAGG - Intergenic
1032128651 7:129212093-129212115 TGGGCCGGAAGAAGAAGAGGAGG + Exonic
1032656101 7:133931761-133931783 TGGGTTGGTAGCAGAACACCAGG - Intronic
1032665220 7:134029419-134029441 AGGGCTGGATGGAGAATAGCGGG + Intronic
1032708423 7:134442052-134442074 TGGGCTGTGATCAGGACAGCAGG - Intergenic
1032756975 7:134900412-134900434 TGGACTGGAAGCAGAAGGGATGG + Intronic
1034449971 7:151132083-151132105 TGGGCTGAAAGCAAGACAGAGGG + Intronic
1035400814 7:158564483-158564505 TGGGATGGCAGCCGCACAGCTGG - Intronic
1035604420 8:920265-920287 TGGGCTCCCAGCAGGACAGCAGG + Intergenic
1036361012 8:8076938-8076960 TGGGGTGGAGGCAGACAAGCAGG - Intergenic
1036545821 8:9768648-9768670 GGGGCAGGAAGCAGAAGACCAGG + Intronic
1036889952 8:12590063-12590085 TGGGGTGGAGGCAGACAAGCAGG + Intergenic
1037200018 8:16240981-16241003 TTGACTGGAAGAAGAACAGATGG + Intronic
1037484317 8:19333079-19333101 CCGGCTGAAAGCAGAACAGGAGG + Exonic
1038253862 8:25932120-25932142 TGGACTGGAGGCAGAAGACCTGG + Intronic
1038487878 8:27949649-27949671 TGGGGTGGAAGGAGGACAGGAGG - Intronic
1039521787 8:38177316-38177338 TGGGGTCGAAGCAGAAAAGGAGG - Intronic
1039906608 8:41791009-41791031 TGGGCTGACAGCAGGACAGAGGG + Intronic
1040737446 8:50526122-50526144 TGGTCTGGCTGCAGAACTGCAGG + Intronic
1042945365 8:74148751-74148773 TGGTCTGGAAGCAGGAGACCTGG + Intergenic
1042987917 8:74604355-74604377 TGGGCTGGAAGGGGAAGGGCGGG + Intronic
1045176667 8:99732450-99732472 TGGGATGTTAGCAGCACAGCAGG - Intronic
1049397063 8:142405801-142405823 TGTGCTGGGAGCAGAGCAGGAGG - Intergenic
1049497896 8:142945254-142945276 TGGGCTGGGAGAGGCACAGCTGG + Intergenic
1049592175 8:143467746-143467768 GGGGCTGGAGGGAGAACAGCTGG - Intronic
1049602859 8:143515965-143515987 TGGGCTGGAAGCGGCAGGGCTGG - Intronic
1051618323 9:19027778-19027800 TGGGCTGGAAGCCATCCAGCTGG - Intronic
1053311782 9:37025141-37025163 TGGGCTGGGACCAGAACAGGGGG + Intronic
1054910443 9:70450452-70450474 GGGGCTGGAAACCGAAGAGCTGG - Intergenic
1055432409 9:76257594-76257616 TGTGCTGGAAGCTGAACTGGAGG - Intronic
1055565541 9:77564879-77564901 TGGACTGGAAGCAGGGCAGGTGG - Intronic
1057431209 9:94996026-94996048 GGGGGTGGAAGCAGAACACAGGG + Intronic
1058207271 9:102124570-102124592 GAGGCTGGAAGCACACCAGCAGG - Intergenic
1060021529 9:120135390-120135412 TGGGCTGGAAGATGGATAGCAGG - Intergenic
1060372911 9:123091515-123091537 TGAGCTGAAAGCAGAGTAGCTGG - Intronic
1061605153 9:131704421-131704443 TGTGCTGGAAGCAGATTGGCAGG - Intronic
1061798306 9:133101141-133101163 TGGGCTGGTACCAGAGCCGCAGG - Intronic
1061862562 9:133475528-133475550 TGGGCATGAAGCTGAGCAGCAGG + Exonic
1062434764 9:136542012-136542034 TGGGCTGGAAACAGCTCACCGGG + Intronic
1186063585 X:5737964-5737986 TGGGTTGGAGGCAGCACGGCTGG - Intergenic
1186858306 X:13646834-13646856 TGGGCTAGAAGCAGAACTGTGGG + Intergenic
1186958921 X:14713765-14713787 TGGGCTAGAGGGAGAACAGCAGG + Intronic
1187737040 X:22315256-22315278 TGGGGTGGAAGAAGCAGAGCTGG + Intergenic
1189322805 X:40096815-40096837 TGGGCTGGAAGCTGGGAAGCTGG - Intronic
1189723158 X:43941095-43941117 TGTGCTGAAAGCAGAGAAGCAGG - Intergenic
1193649106 X:84108978-84109000 TGGGCTCTAAGAAGAACACCAGG - Intronic
1196169615 X:112573334-112573356 TGGGGAGGATGTAGAACAGCTGG + Intergenic
1197702608 X:129610504-129610526 TGGGCCAGAGGGAGAACAGCTGG + Intergenic
1198257234 X:134934293-134934315 AGGTCAGGAAGCAGAAAAGCAGG + Intergenic
1198498687 X:137220525-137220547 TGGGCTGGAAGCACTCTAGCAGG + Intergenic
1199078772 X:143553142-143553164 TGGCAAGGAGGCAGAACAGCTGG + Intergenic
1200081088 X:153576711-153576733 TGGGCTGAGAGCAGAGCAGGAGG + Intronic
1200162802 X:154018038-154018060 TGGGCAGGAAGCCGTACACCAGG + Exonic