ID: 934656989

View in Genome Browser
Species Human (GRCh38)
Location 2:96121586-96121608
Sequence CTGTGTAACTGGCATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 239}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934656989_934656997 9 Left 934656989 2:96121586-96121608 CCCTCCCCATGCCAGTTACACAG 0: 1
1: 0
2: 2
3: 15
4: 239
Right 934656997 2:96121618-96121640 ACCTTGCTTTCCCCTGCCTCAGG 0: 1
1: 0
2: 2
3: 22
4: 334
934656989_934657003 22 Left 934656989 2:96121586-96121608 CCCTCCCCATGCCAGTTACACAG 0: 1
1: 0
2: 2
3: 15
4: 239
Right 934657003 2:96121631-96121653 CTGCCTCAGGGCCTTTGCACTGG 0: 52
1: 162
2: 256
3: 399
4: 755
934656989_934656999 10 Left 934656989 2:96121586-96121608 CCCTCCCCATGCCAGTTACACAG 0: 1
1: 0
2: 2
3: 15
4: 239
Right 934656999 2:96121619-96121641 CCTTGCTTTCCCCTGCCTCAGGG 0: 1
1: 0
2: 4
3: 43
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934656989 Original CRISPR CTGTGTAACTGGCATGGGGA GGG (reversed) Intergenic
900649221 1:3722839-3722861 CTCTGCACCTGGCATGGGGCTGG + Intronic
900649241 1:3722923-3722945 CTCTGCACCTGGCATGGGGCTGG + Intronic
900649255 1:3722979-3723001 CTCTGCATCTGGCATGGGGCTGG + Intronic
900791875 1:4686072-4686094 CTGTGTATCTGGCATGTGCCAGG + Intronic
902542420 1:17164499-17164521 CTGTGTGCCTTGCCTGGGGAGGG + Intergenic
904825841 1:33273209-33273231 CTGTGTGACAGGCACAGGGAAGG - Intronic
905456744 1:38093453-38093475 CTATGTACCTGGCATTGGGCTGG - Intergenic
905694425 1:39964541-39964563 GTGTGGAACTCACATGGGGAAGG + Intronic
906041177 1:42788856-42788878 CTGAGAAACAGACATGGGGATGG + Intronic
906273125 1:44497028-44497050 CTGTGACACTGGCCTAGGGATGG + Intronic
911158004 1:94655461-94655483 GTGTGCAACTGGGGTGGGGATGG + Intergenic
912050392 1:105522450-105522472 CTGAGTCAATGGCATGGGAAAGG - Intergenic
912050963 1:105527216-105527238 CTGGAGAACAGGCATGGGGATGG - Intergenic
913395711 1:118369529-118369551 GTGTGTTACTGGCATAAGGATGG - Intergenic
917109577 1:171532268-171532290 CTGGGTATCAGGCATGGAGAAGG - Intronic
919989689 1:202700804-202700826 ATATGTAACTGGAAAGGGGAGGG + Intronic
922883064 1:228997150-228997172 CTGGGGAAGTGGCATGGGGTAGG + Intergenic
923392176 1:233523364-233523386 CTGAGTTGCTGGGATGGGGATGG - Intergenic
1064111235 10:12540999-12541021 CTGTGTAATTGTCAGGTGGAGGG + Intronic
1064934236 10:20662335-20662357 ATGTGTGTGTGGCATGGGGAAGG - Intergenic
1065762205 10:28992775-28992797 CTTTGGAACTGGCTTAGGGAGGG + Intergenic
1066095921 10:32071968-32071990 CTGTGTAACCCGCAGGGAGAGGG - Intergenic
1066421886 10:35271455-35271477 CTGTGCTTCTGGCAGGGGGAAGG + Intronic
1066642905 10:37574087-37574109 GTGTCTAAATGCCATGGGGATGG + Intergenic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1067720133 10:48721975-48721997 CTGTGTTCCTGGCATGCGGTGGG - Intronic
1068928477 10:62564520-62564542 CTGTGGAACTGGCTTGGGGTAGG - Intronic
1069550881 10:69363175-69363197 CTGTGTCACTGCCATGTGTAAGG + Intronic
1070468419 10:76749757-76749779 CTGTGTCTCTGACAAGGGGAAGG + Intergenic
1070488600 10:76954375-76954397 CTGACTGACTGGCATGAGGATGG + Intronic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1073037344 10:100573277-100573299 CTGTGTGGCGGGCATGGGGAGGG + Intergenic
1074606837 10:114980248-114980270 CTGTCTCACTGGCTTGGAGAGGG + Intergenic
1075175274 10:120154535-120154557 TTGTGTCTCTGGCTTGGGGATGG - Intergenic
1075894912 10:125986781-125986803 CTGAGGAACAGGCATGGGGCAGG - Intronic
1076590064 10:131576839-131576861 CTGTGCCACTGCAATGGGGATGG - Intergenic
1078436075 11:11327024-11327046 ATGAGTGCCTGGCATGGGGAAGG - Intronic
1079787641 11:24694926-24694948 CTGTGTAGGGGGCAAGGGGAGGG + Intronic
1079932717 11:26585100-26585122 CTGTGAAACTGGTTTGGAGATGG - Intronic
1080781578 11:35434604-35434626 CTGTGTTACTGACCTGGGGAAGG - Exonic
1083110789 11:60404657-60404679 TTGTATAACTGGCCTGGTGACGG - Intronic
1083762448 11:64826114-64826136 CATAGTACCTGGCATGGGGAAGG - Intronic
1084150070 11:67283983-67284005 CTGTGATCCTGGCCTGGGGAAGG + Intronic
1084362696 11:68679223-68679245 CTGTGTTACTGGAGTGGGGCTGG + Intergenic
1084560005 11:69899303-69899325 CTCTGTAACCAGAATGGGGAGGG - Intergenic
1085685658 11:78619896-78619918 CTGGGCAACAGGCATGGGAATGG + Intergenic
1089707883 11:120293706-120293728 CTGTGAAAATGTCATGGGGAGGG + Intronic
1089781426 11:120875687-120875709 CTGTGTCATTGGCATGGGGGTGG - Intronic
1089866178 11:121634173-121634195 CTGTGGAACTGGGTGGGGGAGGG + Intergenic
1090339947 11:126009033-126009055 CTGTGTAACAGGTATAGTGAAGG - Intronic
1091444115 12:533851-533873 TTCTGTAACAGGCCTGGGGAGGG - Intronic
1092092969 12:5819343-5819365 CTGGATAACAGGCATGGGAATGG + Intronic
1093049957 12:14493245-14493267 CTGAAGAACAGGCATGGGGATGG - Intronic
1093071811 12:14713779-14713801 CTGTGTAACTGCCATGCAGAAGG + Intergenic
1096522049 12:52189881-52189903 CTGTGCCCCTGCCATGGGGATGG - Intronic
1097821735 12:64134797-64134819 CTGGATAACAGGCATGGGAATGG - Intronic
1098209494 12:68148771-68148793 CTGTGGCTCTGGCAGGGGGAGGG - Intergenic
1098790450 12:74816415-74816437 CTGTGGAACTGGCAGGGGCTGGG + Intergenic
1099119004 12:78664663-78664685 CTGTGTAAAAGGGATGGGGTAGG - Intergenic
1099934258 12:89106906-89106928 CAGTGAAACTGGCATGGATAAGG + Intergenic
1101944899 12:109129392-109129414 CTGTGTCACTGGCATGTGTGTGG - Intronic
1102813896 12:115846865-115846887 CTGTGTTCCTGGCATGGAGCTGG - Intergenic
1104038271 12:125113529-125113551 CTGTGTGTCTGGCAGGGGCAGGG - Intronic
1106198680 13:27517027-27517049 CTGTCAAACTGGATTGGGGAGGG - Intergenic
1106396267 13:29383849-29383871 CTATGTAAGTGGCCTGTGGATGG - Intronic
1108800068 13:54084095-54084117 CTGTGTGACTGGCAGGTGGTCGG - Intergenic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1114468786 14:22944222-22944244 CTCTCTAAATGGCATGGGGATGG - Intergenic
1115405148 14:33006484-33006506 GTGAGTAATTGGCAGGGGGAGGG + Intronic
1116931495 14:50695343-50695365 CTGGGTAACAGGCAGGGGGTTGG - Intergenic
1117086221 14:52204384-52204406 ATGTGTATTTGGCCTGGGGACGG + Intergenic
1119726561 14:76925008-76925030 CTGTGTCACTGTCGTGGGGCAGG + Intergenic
1120948964 14:90023340-90023362 CTGTGTGCTTGGAATGGGGATGG + Intronic
1121288464 14:92755162-92755184 CTGTGCAACTGGAAGGGGAAAGG - Intergenic
1121421470 14:93818711-93818733 GGGTGTCACTGGCATAGGGATGG - Intergenic
1122386360 14:101350965-101350987 CCGAGTTACTGGCATTGGGAAGG - Intergenic
1123029763 14:105446171-105446193 CTGTGTCAGTAGCATGTGGAGGG - Intronic
1125362684 15:38880592-38880614 CTGTGTGACTAGGGTGGGGAAGG + Intergenic
1126415385 15:48412718-48412740 CTGTGTTTCTGGAATGGGCATGG - Exonic
1126750021 15:51867096-51867118 CAGTGTGACTGGAATGGAGAGGG + Intronic
1128206120 15:65853665-65853687 TTTTCTAACTGGCATGTGGAGGG - Intronic
1128393986 15:67204831-67204853 CTGTGAAAGTGGGATGGGCAGGG - Intronic
1129065703 15:72902221-72902243 CTGTGTGCATGGCATGGAGAAGG - Intergenic
1129656148 15:77526904-77526926 CTGTGTGGCTGGCCTGGGAAAGG + Intergenic
1129858713 15:78843679-78843701 CTGTGTATGTAGCATGGGGCTGG - Intronic
1134551792 16:15142043-15142065 CTGTGAAACTGCCCCGGGGAGGG + Intergenic
1138483376 16:57318786-57318808 CTGTGCTTCTGACATGGGGAAGG - Intergenic
1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG + Intergenic
1140246206 16:73252343-73252365 CTGGGGTAGTGGCATGGGGACGG + Intergenic
1140492305 16:75347961-75347983 CTGAGAAACTGTCATGGGGCGGG + Intronic
1142076559 16:88121205-88121227 CTGTGTACCATGCATGGTGAAGG + Intergenic
1142521491 17:507890-507912 CAGTGTCACTGGGATGGAGAAGG - Intergenic
1142929129 17:3267390-3267412 CTCTGTAGCTAGCAAGGGGATGG + Intergenic
1145204535 17:20975889-20975911 CTTTAGAACTAGCATGGGGATGG + Intergenic
1145413559 17:22694592-22694614 CTGTGTGACTGGTGCGGGGAGGG - Intergenic
1151110093 17:71666197-71666219 CTGAGTAAGTGGCATGGAAACGG + Intergenic
1151959998 17:77400769-77400791 CTGTGGGTCTGGCCTGGGGAAGG + Intronic
1152253602 17:79224610-79224632 CTGTTTAGATGGCATGGGTAAGG - Intronic
1152267100 17:79301517-79301539 CTGTGAGACTGGCCTGTGGATGG - Intronic
1152492373 17:80645827-80645849 CTGTGCCACTGTCATGGGCAGGG - Intronic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1156454180 18:37283604-37283626 CTATAAAACTGGCATGGTGATGG + Intronic
1156619147 18:38828195-38828217 TTGAGTCAGTGGCATGGGGAAGG - Intergenic
1157731750 18:50010086-50010108 CTGTGTAATTGGCATTTGGCAGG + Intronic
1158186407 18:54776726-54776748 CTGTGTGACTGACATGGTGCTGG - Intronic
1160512337 18:79459555-79459577 CTTTGGCACTGGCAAGGGGAGGG - Intronic
1161854960 19:6759022-6759044 CTGTGTGACCAGCATGAGGAGGG + Intronic
1162672422 19:12268187-12268209 CTTTGTGACTGGGGTGGGGAAGG - Intronic
1164259314 19:23555404-23555426 TTGAGGAACTGCCATGGGGAAGG - Intronic
1165930868 19:39357614-39357636 CTGTGAGATTGGCATTGGGATGG + Intronic
1166966209 19:46530694-46530716 CACTGTACCTGGCCTGGGGAGGG - Intronic
1167346837 19:48951282-48951304 CTCTGTAACTGGAGTAGGGAAGG + Intergenic
924997234 2:373312-373334 CTGTGTAACTGGATGGGGGTTGG + Intergenic
925935596 2:8755842-8755864 ATGTGTCACAGGCATGAGGATGG - Intronic
926070167 2:9881824-9881846 CTGTGTACCAGGCATTGGGGTGG + Intronic
926204721 2:10828014-10828036 CTGTGTGTGTGGCAGGGGGAGGG - Intronic
927286376 2:21361257-21361279 CTGTGTAACTGGTATAAGGGTGG - Intergenic
929785606 2:44988704-44988726 CTGTGAAGCTGGCCTGGGAAGGG - Intergenic
929861850 2:45684865-45684887 CTGTGTGGCTGGCAGGGGGCTGG + Intronic
932023234 2:68109480-68109502 TGGTGAAACTGGCATGGGAAGGG - Intronic
932083945 2:68740640-68740662 CTGTTTAAATGGCCTGGGAAAGG - Intronic
932743196 2:74307808-74307830 CTGGGGGCCTGGCATGGGGATGG - Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934656989 2:96121586-96121608 CTGTGTAACTGGCATGGGGAGGG - Intergenic
934780978 2:96969555-96969577 CGGTGTGCCTGGCATTGGGAGGG - Intronic
935009362 2:99117821-99117843 CTGTGTGACTGGAATCAGGAAGG + Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
938501172 2:131831899-131831921 GTGTGTCACTGTCATGGGCAGGG - Intergenic
939041951 2:137200611-137200633 ATGTGTGACTGGGATGGGGCAGG - Intronic
939343134 2:140926890-140926912 CTGTGTAACTTGCATTGATATGG + Intronic
940859991 2:158761534-158761556 CTGGGGAGCTGGGATGGGGAGGG + Intergenic
941339955 2:164294746-164294768 CTGTGTAACTCCCCTGGGAAAGG - Intergenic
942728695 2:179039612-179039634 CTGTGAAAATGGCATTGGAAGGG - Intronic
943392202 2:187284095-187284117 CTGGAGAACAGGCATGGGGATGG - Intergenic
945198206 2:207257013-207257035 CTGTGCATGTGGCAGGGGGAAGG + Intergenic
1170428492 20:16258094-16258116 GTGTGTGTTTGGCATGGGGAAGG - Intergenic
1170762772 20:19265363-19265385 CTGTGTTCATGGCATGGGGAGGG + Intronic
1174129957 20:48336819-48336841 CTGAGTCACTGGAATGGGAATGG + Intergenic
1174648115 20:52103524-52103546 CAGTGTTTCGGGCATGGGGAGGG - Intronic
1174757414 20:53173701-53173723 TTGTGTAACTGAAAAGGGGATGG + Intronic
1174915899 20:54653590-54653612 CTGTGGATCAGGCATGGTGAAGG - Intergenic
1177143815 21:17385592-17385614 CCGTGTAACTGGAGTGGGGCAGG - Intergenic
1177505907 21:22016806-22016828 CTGAGGAACAGGCATGGGAATGG - Intergenic
1182427994 22:30285000-30285022 CTGTGTAGCTGGCTGGGGGCTGG - Intergenic
1183243875 22:36678666-36678688 GTGAGTGACTGGCATGGGGGTGG - Intronic
1183276316 22:36900384-36900406 CGGGGTGACTGGCATGGGGGTGG - Intergenic
1184078048 22:42196099-42196121 CTGTGTAACCTGCAAAGGGAAGG + Intronic
1184109569 22:42387144-42387166 GTGTGTAACAGGCAGGGGGCTGG - Intronic
950256429 3:11510456-11510478 CTGTATCACTGGGATGGGGGAGG - Intronic
951509772 3:23487436-23487458 CTGTGAAGCTGGCAGGGGCAGGG - Intronic
952261242 3:31742579-31742601 CTGTAAAACAGGCTTGGGGAAGG - Intronic
953610432 3:44443184-44443206 CTGGGGGGCTGGCATGGGGAAGG + Exonic
955024003 3:55149691-55149713 CTGTGTAGAAGGCATTGGGATGG - Intergenic
955204096 3:56879444-56879466 CTGTGTATCTAGCATTGGGCTGG + Intronic
955375005 3:58387443-58387465 CTGTGTAACTGTCATGGAGTAGG - Intronic
957453323 3:80408506-80408528 CTGTGTAAGTGACAGGGGAAAGG - Intergenic
958608135 3:96386937-96386959 TTTTGTAAGTGGCATGAGGAAGG + Intergenic
958730730 3:97957613-97957635 CTGTTTAATGGGCATGGGCATGG + Intronic
959599590 3:108165728-108165750 CTGTGTACCTCGCATGGGCATGG + Intronic
963273446 3:143307842-143307864 CTGAGTCACAGGCATGGGGCTGG - Intronic
963630005 3:147720930-147720952 CTGTAGAACAGGCATGGGAATGG + Intergenic
963973281 3:151453001-151453023 CTGTGTGCCTGGGATGGGCAGGG + Intronic
964506184 3:157402316-157402338 ATGTGTAGCTGTCATGGAGAAGG + Intronic
965669001 3:171127081-171127103 CTCTGTGCCTGGCATGGGGAAGG + Intronic
967505578 3:190249473-190249495 CTGGGGAACAGGCATGGGAATGG - Intergenic
968384287 4:122670-122692 CTGGGTACCTGGAATGTGGATGG + Intergenic
968963711 4:3758874-3758896 CTGGGTACCTGGCTTGGGGGAGG - Intergenic
969233809 4:5851199-5851221 CTGTGTGAGTGGCATGCAGAAGG - Intronic
969313288 4:6366761-6366783 CTGGGTCCCTGGCATGGGGCAGG - Intronic
972095222 4:35340391-35340413 CTGCATAACTGGCATGAGAATGG + Intergenic
972808371 4:42554817-42554839 TTGAGTAAGTGGGATGGGGAAGG + Intronic
973014949 4:45126473-45126495 CTGTGTAACTGCAGTGGGGCTGG + Intergenic
974084198 4:57242179-57242201 CAGTGTGATTGGAATGGGGAAGG + Intergenic
975733997 4:77364313-77364335 CTGGAGAACAGGCATGGGGATGG - Intronic
976209676 4:82655003-82655025 CTTTCTGACTGGCATGGTGAGGG - Intronic
977304885 4:95310791-95310813 TTGTGTAACTGGGTTGGGGGGGG + Intronic
979133054 4:117072975-117072997 CTGTGTTTATGGCCTGGGGAAGG - Intergenic
979612844 4:122707669-122707691 CTGTGCAACTGGCCTGGCTAGGG - Intergenic
981800448 4:148649101-148649123 CTGTGTATCTTGCATGGAGATGG + Intergenic
983324276 4:166233491-166233513 CTGGGTAGGTGGCATGTGGACGG + Intergenic
984383443 4:179025864-179025886 CTGTGTGACCCACATGGGGAAGG - Intergenic
985134693 4:186774641-186774663 GTGTGAAACTGGAATGGGAAGGG - Intergenic
986443527 5:7801277-7801299 CTGTGTGTCTGGCAGGGCGAGGG - Intronic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
989252289 5:39331731-39331753 CTCTGTAACCGGGATCGGGATGG - Exonic
992503691 5:77365487-77365509 CTGTGGAACTGCCAGGGGTAGGG + Intronic
992676934 5:79114413-79114435 CTGTCCAAATGGCATGGGAAGGG + Intronic
994291677 5:98034274-98034296 CTGTGGAACAGGCATAGGAATGG - Intergenic
994698515 5:103103282-103103304 CTGTGTAACTCCACTGGGGAAGG + Intronic
995027218 5:107438291-107438313 CTGTGTAATTGGGATGGCAATGG - Intronic
997183879 5:131861491-131861513 ATGTTTAATGGGCATGGGGAAGG + Intronic
997424195 5:133792091-133792113 CTGTGAACCTGGCAGGAGGAAGG - Intergenic
1000706227 5:164515493-164515515 CAGTGGAACTGGCCTAGGGAAGG - Intergenic
1001106431 5:168858528-168858550 CTATGTAAGTGGCATTTGGATGG - Intronic
1002182443 5:177437744-177437766 CTGTGTGACAGTCATAGGGAAGG + Intronic
1002422265 5:179154795-179154817 ACGTGTAAGTGGCCTGGGGAAGG - Exonic
1002804883 6:563381-563403 CTGTGTAAATGGGAAGGGAATGG - Intronic
1003680046 6:8244006-8244028 CTGAGCAACTGACATAGGGAAGG + Intergenic
1004870462 6:19899098-19899120 CTGTGGAGCTGGCATGGGTCTGG - Intergenic
1005622761 6:27635289-27635311 CTGGAGAACAGGCATGGGGATGG - Intergenic
1007353714 6:41294629-41294651 CTGGTAAAGTGGCATGGGGAAGG - Intergenic
1007538523 6:42619060-42619082 CTGTGGTACTGGCATGGAAATGG - Intronic
1010971882 6:82271820-82271842 CTGTGTAACTGGCAGTGGGCAGG + Intergenic
1012640908 6:101612135-101612157 CTGTGTAACTGACCTTAGGAAGG + Intronic
1016041726 6:139438531-139438553 TTCTGTGACTGGCATGGGCATGG - Intergenic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017584762 6:155908777-155908799 CAGAGTAACTGAGATGGGGAAGG + Intergenic
1019549706 7:1595870-1595892 CTGTGGCACGGGCATGGGGTGGG + Intergenic
1019647776 7:2140212-2140234 CTGGGACACTGGCCTGGGGAAGG - Intronic
1028743879 7:94306313-94306335 CTGAGTAACTGGCAGGGGGAGGG - Intergenic
1029997030 7:105015797-105015819 TTTTGTAACTGGCTCGGGGAAGG - Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1037634972 8:20693353-20693375 GTGTGTAAGTGGCCTGGGGGAGG + Intergenic
1038005605 8:23427362-23427384 CTGTGTGACTGGAAGGGGAAAGG - Intronic
1038197719 8:25383435-25383457 CTGTGTGCCAGGCATAGGGAAGG + Intronic
1038446932 8:27611007-27611029 CTGTGGAGGTGGCATGGGGAGGG - Intronic
1041365384 8:57097295-57097317 ATGTGGTACTGGCATAGGGATGG - Intergenic
1041405183 8:57491142-57491164 GTATGTATCTGGCATGGGAACGG - Intergenic
1045913602 8:107439939-107439961 GTGGGTAATTGGAATGGGGAGGG + Intronic
1047760001 8:127947488-127947510 CAGTGTGCCTGGCATTGGGATGG - Intergenic
1048312875 8:133339272-133339294 CTATGTAACTGTCATGGAGCAGG - Intergenic
1049808610 8:144553012-144553034 CTGTGGGGCTGGCATGGGGCTGG + Intronic
1049860528 8:144895210-144895232 GTGTGTAACTTGTATGTGGAAGG - Intronic
1051405018 9:16727630-16727652 CTGTGTTACTGGAATGTGCAGGG - Intronic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1053360489 9:37483112-37483134 CTGTGTAACTGGGATGGGGCAGG - Intergenic
1054921368 9:70546009-70546031 CTGAGCAACTGGCATGAGCAAGG - Intronic
1055203110 9:73692180-73692202 CTTTGTAACTGCCAAGGGCATGG + Intergenic
1057181798 9:93034632-93034654 CTGGGGATCTGACATGGGGATGG - Exonic
1057272729 9:93659843-93659865 CTCTGAAACTCCCATGGGGAGGG + Intronic
1057316285 9:93970834-93970856 CTGGAGAACAGGCATGGGGATGG + Intergenic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1058255426 9:102756482-102756504 CTGAGTCACAGGCATGGTGAAGG - Intergenic
1059239810 9:112794472-112794494 CTGTGTACCTGGCACGAGGGGGG + Intronic
1059669005 9:116475878-116475900 GAGTGTAACTGGAATGTGGAAGG - Intronic
1061052916 9:128206616-128206638 CTGTGTAACTTGCCAGGGGCGGG + Intronic
1061513253 9:131073449-131073471 CAGTGTCACCAGCATGGGGAGGG + Intronic
1186658357 X:11640988-11641010 CTGTGTAAGTGACAGGGGCATGG + Intronic
1186885209 X:13906228-13906250 CTTTGTAACTGGTTAGGGGAGGG - Intronic
1188198564 X:27270744-27270766 CTGTGTGCCTGGCAATGGGATGG + Intergenic
1188996044 X:36887375-36887397 CTGTGTGACTGGAAAAGGGAGGG + Intergenic
1190283650 X:48947966-48947988 CTTTGCATCTGGCATGGGGCAGG - Intronic
1190731802 X:53231492-53231514 CTGTGTGTCTGGCATGAGGTAGG + Intergenic
1191780242 X:64856731-64856753 CAGTGTAACTGAAAGGGGGATGG - Intergenic
1192065490 X:67880415-67880437 CTGTGGACCTGGCATGGTGGTGG + Intergenic
1195116514 X:101704401-101704423 GTGTGTATGTGGAATGGGGATGG - Intergenic
1195676164 X:107508664-107508686 CTGGGCAACTGGCTTGGGGGAGG - Intergenic
1199275772 X:145940174-145940196 CTGGGGAACAGGCATGGGAATGG + Intergenic
1201299498 Y:12493632-12493654 ATTTGTAACTGTCATGGGGCTGG + Intergenic
1202341346 Y:23872180-23872202 CTGGAGAACAGGCATGGGGATGG - Intergenic
1202529420 Y:25797906-25797928 CTGGAGAACAGGCATGGGGATGG + Intergenic