ID: 934660802

View in Genome Browser
Species Human (GRCh38)
Location 2:96142759-96142781
Sequence GCGTGCACACACGCTCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934660798_934660802 0 Left 934660798 2:96142736-96142758 CCTGGGAAGTGCCTCTTGTGTGG 0: 1
1: 0
2: 1
3: 18
4: 173
Right 934660802 2:96142759-96142781 GCGTGCACACACGCTCCCACAGG 0: 1
1: 0
2: 1
3: 13
4: 149
934660792_934660802 30 Left 934660792 2:96142706-96142728 CCTGCTGTGAGGAAGTAGAGACC 0: 1
1: 0
2: 1
3: 15
4: 347
Right 934660802 2:96142759-96142781 GCGTGCACACACGCTCCCACAGG 0: 1
1: 0
2: 1
3: 13
4: 149
934660797_934660802 8 Left 934660797 2:96142728-96142750 CCACACGGCCTGGGAAGTGCCTC 0: 1
1: 0
2: 0
3: 21
4: 196
Right 934660802 2:96142759-96142781 GCGTGCACACACGCTCCCACAGG 0: 1
1: 0
2: 1
3: 13
4: 149
934660796_934660802 9 Left 934660796 2:96142727-96142749 CCCACACGGCCTGGGAAGTGCCT 0: 1
1: 0
2: 1
3: 11
4: 143
Right 934660802 2:96142759-96142781 GCGTGCACACACGCTCCCACAGG 0: 1
1: 0
2: 1
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934660802 Original CRISPR GCGTGCACACACGCTCCCAC AGG Intergenic
900222855 1:1518613-1518635 GCGTACACACCCCCCCCCACAGG + Intronic
900293790 1:1938440-1938462 GCTCACACACACACTCCCACAGG + Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
900620569 1:3585257-3585279 GCGTCCACACACCCACACACAGG - Intronic
900620613 1:3585624-3585646 GCGTCCACACACCCACACACAGG - Intronic
900620656 1:3585959-3585981 GCGTCCACACACCCACACACAGG - Intronic
900620664 1:3586013-3586035 GCGTCCACACACCCACACACAGG - Intronic
901849066 1:12003860-12003882 GGCTGCACACACGCACCCAGGGG - Intronic
903078531 1:20790097-20790119 GAGTGCACACACACACACACGGG + Intergenic
904303954 1:29575037-29575059 GCGTGCACACACATGCACACTGG + Intergenic
905839362 1:41162004-41162026 GCCTGCTCCCAGGCTCCCACCGG - Intronic
907126714 1:52056592-52056614 GCGGGCCCGCTCGCTCCCACAGG - Intronic
907186313 1:52612083-52612105 GCTTGCACACATGTTCACACTGG + Intergenic
911885734 1:103296772-103296794 TCATGCACACAGGCTCCCAGTGG - Intergenic
913157243 1:116111937-116111959 GCATGCACACACGTACACACAGG - Intronic
913210095 1:116575332-116575354 GCCTGCACACACTGTCTCACAGG + Exonic
913477695 1:119254492-119254514 GTGAGCACACATGCTCCTACTGG - Intergenic
915008287 1:152661147-152661169 ACATGCACACACGCACACACAGG + Intergenic
916166441 1:161970639-161970661 GGGTGCACTCAGCCTCCCACTGG - Intergenic
917614440 1:176725706-176725728 GCGCGCACACACACACTCACGGG + Intronic
920037567 1:203075898-203075920 GTGCGCACACACGCTCCCCGCGG - Intronic
920746614 1:208635083-208635105 GCATGCACACACACACACACAGG - Intergenic
921938335 1:220815201-220815223 GTGTACACTCACTCTCCCACGGG - Exonic
922831119 1:228555064-228555086 GCGTGCTCACACACACACACAGG - Intergenic
1062843848 10:689871-689893 GCGCGCAGAGACGCTCCCGCCGG - Intergenic
1062999673 10:1904182-1904204 ACGTGCACACACGCATGCACAGG + Intergenic
1066501961 10:36003357-36003379 GCGTGCACACACACCCTCCCGGG - Intergenic
1066653529 10:37680556-37680578 CCGTGCCCACACGCTGCCCCAGG + Intergenic
1070518552 10:77230639-77230661 GCTTGCACCCAGGCTCACACTGG + Intronic
1072122808 10:92419515-92419537 GTGTGCAGCCACTCTCCCACTGG + Intergenic
1077753161 11:4996248-4996270 GCATGCACACACACACACACAGG + Intergenic
1080704654 11:34678931-34678953 GCGTGCACACACACACACAGAGG - Intergenic
1081872515 11:46389940-46389962 GCATGCTCACGCGCTCTCACGGG - Intergenic
1083267237 11:61552307-61552329 GCGTCCTCACACGCACCCATGGG + Intronic
1083267758 11:61554836-61554858 ACATGCACACACACTCGCACAGG + Intronic
1083301540 11:61742220-61742242 GCGTGCACACATGCTCACAGGGG + Intronic
1084509716 11:69595615-69595637 GGGTGCCCACCCTCTCCCACTGG + Intergenic
1084734841 11:71098031-71098053 GCATGCACACATGCACACACAGG - Intronic
1088167737 11:106957687-106957709 GCGTGTTCAGAGGCTCCCACTGG - Intronic
1089214305 11:116826577-116826599 GCGTGCACCCACGCTCGCGAGGG + Intergenic
1089735429 11:120547361-120547383 TCGTGCAGACACTCGCCCACTGG - Intronic
1092563652 12:9642350-9642372 GCCTGCACCCACAATCCCACGGG + Intergenic
1093894624 12:24562481-24562503 GCGCGCACACACACACACACCGG - Intergenic
1103653702 12:122453897-122453919 GCACGCACACACGCACCCTCTGG + Intergenic
1108753635 13:53474200-53474222 GTGTGCACACACACACACACTGG + Intergenic
1108816994 13:54304780-54304802 TCCTGAACACACACTCCCACTGG + Intergenic
1112007335 13:95265729-95265751 GTGAGCACACACACGCCCACAGG - Intronic
1113892499 13:113743777-113743799 CCAAGCACACACGCTCACACAGG - Intergenic
1114382866 14:22226639-22226661 GTGTGCACGCACGCGCACACAGG + Intergenic
1114947340 14:27700502-27700524 GCGTGCACGCACGCGCGCACAGG - Intergenic
1115705169 14:35990831-35990853 TCATGCACACACACTCACACAGG - Intergenic
1119695934 14:76713488-76713510 CCGTGCACACACGCACACAGAGG + Intergenic
1126506175 15:49406712-49406734 ACGTGCACACACACACACACTGG + Intronic
1127637849 15:60888502-60888524 ACATGCACACACACTCACACTGG + Intronic
1129297362 15:74607117-74607139 GCATGCACACACACACCCCCAGG - Intronic
1129458053 15:75686269-75686291 GTGTGCACACACACACACACAGG + Intronic
1131749891 15:95495115-95495137 CCCTGCACACACGCACACACAGG - Intergenic
1132632469 16:926033-926055 GTGTGCACACATGCGCACACAGG - Intronic
1132821642 16:1875512-1875534 GTGTGCACCTACGGTCCCACGGG - Intronic
1133232195 16:4372077-4372099 GCGCGCACACACGCACTCTCGGG + Intronic
1141054685 16:80804248-80804270 GCGCACACACACGCGCACACCGG - Exonic
1142106402 16:88305620-88305642 ACGTGCACACACATTCTCACAGG + Intergenic
1143001151 17:3795956-3795978 GGATGCACACACGCACACACAGG - Intronic
1143587603 17:7858320-7858342 GCGTGCACACACACACACTCCGG - Intronic
1144754087 17:17669024-17669046 GCGCGCACACACACACACACGGG + Intergenic
1146845958 17:36182337-36182359 GCGTGCACACACACACACACAGG - Intronic
1148271700 17:46266798-46266820 GAGGCCGCACACGCTCCCACAGG + Intergenic
1148744154 17:49909145-49909167 GGGTGCACACACACACACACAGG + Intergenic
1149571620 17:57676272-57676294 GCACGCACACACGCACACACAGG + Intronic
1149679375 17:58494526-58494548 GCATGCATACACGCTTACACTGG - Intronic
1152245917 17:79184488-79184510 GCGGCCACACACACACCCACTGG + Intronic
1152253749 17:79225646-79225668 GCATGGACACACGCTCCCCTTGG - Intronic
1152855060 17:82660619-82660641 ACGTGCACACACACACGCACAGG + Intronic
1154423104 18:14251858-14251880 GCGCGCACACACACACACACAGG + Intergenic
1160147029 18:76373713-76373735 GCGTGCACACACACACACGCAGG + Intronic
1160621883 18:80177078-80177100 GCGCGCACACACACACACACGGG + Intronic
1162015363 19:7843831-7843853 GCGTGCACACACGCTTCAGGAGG + Intronic
1162824009 19:13239784-13239806 GCATGCACACACACACACACTGG - Intronic
1165069292 19:33246515-33246537 ACGTGCACACACGTGTCCACAGG + Intergenic
1165097184 19:33416056-33416078 CCGGGCTCACACGCTTCCACAGG - Intronic
1168258589 19:55180265-55180287 ACGGGCACACACGCGCGCACGGG - Exonic
925040399 2:728850-728872 CCTTGCACACACGCACACACAGG - Intergenic
928358968 2:30647857-30647879 GAGTCCTCACAAGCTCCCACAGG - Intergenic
928493342 2:31805885-31805907 ACATGCACACACGCACACACAGG - Intergenic
934660802 2:96142759-96142781 GCGTGCACACACGCTCCCACAGG + Intergenic
935129733 2:100252724-100252746 GTGTGCACACATGCACACACAGG - Intergenic
939704187 2:145431584-145431606 GCGTGCTCACACACACACACTGG - Intergenic
948863295 2:240763266-240763288 GCGTGCGCTCACGCTCCTGCCGG + Exonic
948941496 2:241199266-241199288 ACGTGCACACATGCACCCTCAGG + Intronic
1170781635 20:19430770-19430792 GCATGCACACACACACACACAGG + Intronic
1171349105 20:24489260-24489282 GCATGCACACACGTGCTCACAGG + Intronic
1172773997 20:37396847-37396869 ACGGGCACACAGGCACCCACAGG - Intronic
1176276049 20:64269976-64269998 CCGTGCACACCCGCACTCACAGG - Intronic
1177216515 21:18136602-18136624 ACGCACACACACACTCCCACAGG - Intronic
1179885315 21:44311777-44311799 GCGTGCACACGTGCACACACAGG - Intronic
1180071344 21:45437620-45437642 TCCTGCACACACACTCACACAGG + Intronic
1180071737 21:45440205-45440227 CTGTGCACACAGGCTCCCGCTGG + Intronic
1180172821 21:46068799-46068821 GCGTGCACACACACACACCCAGG - Intergenic
1180958772 22:19753092-19753114 GTGTGCACACTCTCTCACACTGG + Intergenic
1182272802 22:29166071-29166093 GTGTGCACACATGCACACACAGG + Intronic
1182737662 22:32542656-32542678 GCGCGCACACAGGCACACACTGG + Intronic
1185079257 22:48700654-48700676 GCGTGCACACAGGTGCCCACAGG - Intronic
1185334213 22:50264331-50264353 ACGTGCCCACACACACCCACGGG + Exonic
949604157 3:5634969-5634991 TCCTGAACACACGCCCCCACTGG - Intergenic
953429558 3:42827832-42827854 GCGTGGACACTCTCACCCACAGG + Intronic
954714360 3:52519671-52519693 GAGTTCACACAGGCTCACACGGG - Intronic
956659459 3:71583682-71583704 GCGCGCACACACGCACTCCCGGG + Intronic
962304898 3:134277484-134277506 GCATGCACACACACACACACAGG - Intergenic
967351816 3:188522330-188522352 GTGCACACACACGCTCACACTGG - Intronic
968909214 4:3468275-3468297 ACGTGCACACACACTCCCACAGG - Intronic
971268556 4:25115679-25115701 GCCTCCACACAGGCTCCCAAAGG - Intergenic
972822132 4:42713680-42713702 GCATGCACCCACACGCCCACAGG - Intergenic
979446406 4:120818252-120818274 GCGTGCACACACACACACACAGG + Intronic
983895283 4:173074890-173074912 GCGTGCACACACACACACACGGG + Intergenic
984816191 4:183839019-183839041 GCGCGCACACACACACACACAGG + Intergenic
985869321 5:2541363-2541385 GCGTGCACACAGGCACACACAGG - Intergenic
985911675 5:2888690-2888712 GCATGCACACACACACACACGGG - Intergenic
986588782 5:9346736-9346758 GTTTGCACACTCCCTCCCACAGG + Intronic
989198656 5:38741516-38741538 GCGCGCACACACACACACACAGG + Intergenic
989747349 5:44845822-44845844 GCGTGCACACACACACACACGGG + Intergenic
989780039 5:45253950-45253972 GCATGCACAGACCCTTCCACTGG + Intergenic
990068798 5:51752815-51752837 GCGCGCACACACACACACACAGG + Intergenic
995106473 5:108381808-108381830 GCGCACACACACGCACACACGGG + Exonic
998963272 5:147510197-147510219 GCGCGCGCACACGCACACACAGG + Intergenic
1002175386 5:177398549-177398571 GCCTGCACACAGCCTCCCACAGG - Exonic
1002448294 5:179303308-179303330 GCGTGCTCACACCATCCTACTGG - Intronic
1007337491 6:41163919-41163941 CTGTGCACACATGCTCACACTGG + Intergenic
1008484445 6:52020261-52020283 GCGTGCACACACACACCCCTTGG + Intronic
1013165688 6:107589851-107589873 ACGTGCACACACACACACACGGG + Intronic
1018719349 6:166561152-166561174 TTGTGCACACACACTCCCCCTGG + Intronic
1019601803 7:1887842-1887864 ACGTGCACACACACACGCACAGG - Intronic
1020085478 7:5307938-5307960 GCATGCACACACACTCACCCGGG + Exonic
1023044465 7:36199086-36199108 GCATGCACACATTCTTCCACTGG + Intronic
1029438358 7:100574628-100574650 GCGCGCACACACACACACACAGG + Intronic
1029606695 7:101603214-101603236 GCCAGCACAGAAGCTCCCACGGG + Intergenic
1031047334 7:116906579-116906601 GCAGGCACACATGCTCCCTCAGG - Intronic
1034774118 7:153808228-153808250 ACGTGCACACACGCACACTCAGG - Intergenic
1034905959 7:154946472-154946494 GCGTGCACACATACTCACACAGG + Intronic
1034980495 7:155473014-155473036 GCGCGCACACACAGTCCCCCAGG + Intergenic
1035526430 8:316738-316760 CAGTGCACACGCCCTCCCACAGG - Intergenic
1039855650 8:41410300-41410322 ACATGCACACACGTTCACACAGG + Intergenic
1047217056 8:122884745-122884767 CCGGGCTCACATGCTCCCACAGG - Intronic
1047247543 8:123158430-123158452 GCGTCCACACACTCTCCCCAGGG - Intergenic
1048293780 8:133199696-133199718 ACATGCACACACGCACACACAGG + Intronic
1049176392 8:141195267-141195289 ACGTGCTGACACGCTCCCTCCGG - Exonic
1049276398 8:141722202-141722224 ATGTGCACACACACTCACACCGG - Intergenic
1049741074 8:144241205-144241227 GTATGCACACACGCACACACAGG - Intronic
1049741685 8:144244047-144244069 GCGTGCACACACGCAAGCACAGG - Intronic
1049818493 8:144619897-144619919 ACGGGCACACACGCTCTCTCAGG - Intergenic
1049818524 8:144620178-144620200 ACGGGCACACACGCTCTCTCAGG - Intergenic
1055067393 9:72132382-72132404 GTGTGCACTCACCCTCCCTCAGG - Intronic
1056055070 9:82813441-82813463 ACGTGCACGCACACTCCCACTGG - Intergenic
1057772977 9:97983879-97983901 ACTTGCACACGCGCTCCCTCAGG - Intronic
1057848212 9:98541902-98541924 GCGTGCCCACGCGCTTCCACTGG + Exonic
1059061325 9:111037996-111038018 GCGCGCACCCACACTCTCACTGG + Exonic
1061418822 9:130462280-130462302 GCATGTAAACACGGTCCCACTGG - Intronic
1062522251 9:136963012-136963034 GTGTGCACACAGGCACACACAGG + Intergenic
1062583438 9:137238162-137238184 GCGGTAACACACCCTCCCACTGG + Intergenic
1185642373 X:1595619-1595641 GCATGCACACACACACGCACAGG - Intronic
1187931532 X:24297754-24297776 GCGTACACACACACACACACGGG - Intergenic
1193779758 X:85686834-85686856 TCCTGCACACACACCCCCACTGG - Intergenic
1194469771 X:94278961-94278983 GCGCGCACACACACACACACAGG + Intergenic
1200150724 X:153950101-153950123 GCGCGCACACAGCCCCCCACGGG - Intronic
1200414957 Y:2899896-2899918 TCCTGAACACACGCCCCCACTGG + Intronic