ID: 934661810

View in Genome Browser
Species Human (GRCh38)
Location 2:96147055-96147077
Sequence CTAAGGCTACTCCACTGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934661806_934661810 -4 Left 934661806 2:96147036-96147058 CCACACTGGCTCCAACGCTCTAA No data
Right 934661810 2:96147055-96147077 CTAAGGCTACTCCACTGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934661810 Original CRISPR CTAAGGCTACTCCACTGTCT GGG Intergenic