ID: 934663424

View in Genome Browser
Species Human (GRCh38)
Location 2:96154923-96154945
Sequence GTGTGGAAGTTGGGGTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934663424_934663433 13 Left 934663424 2:96154923-96154945 CCCTGCAACCCCAACTTCCACAC No data
Right 934663433 2:96154959-96154981 GTTCTCTGCCCCTGGATTGCTGG No data
934663424_934663437 30 Left 934663424 2:96154923-96154945 CCCTGCAACCCCAACTTCCACAC No data
Right 934663437 2:96154976-96154998 TGCTGGAGCCGCCTCTTCTGTGG No data
934663424_934663432 5 Left 934663424 2:96154923-96154945 CCCTGCAACCCCAACTTCCACAC No data
Right 934663432 2:96154951-96154973 CTCTTGCTGTTCTCTGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934663424 Original CRISPR GTGTGGAAGTTGGGGTTGCA GGG (reversed) Intergenic
No off target data available for this crispr