ID: 934663433

View in Genome Browser
Species Human (GRCh38)
Location 2:96154959-96154981
Sequence GTTCTCTGCCCCTGGATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934663424_934663433 13 Left 934663424 2:96154923-96154945 CCCTGCAACCCCAACTTCCACAC No data
Right 934663433 2:96154959-96154981 GTTCTCTGCCCCTGGATTGCTGG No data
934663422_934663433 21 Left 934663422 2:96154915-96154937 CCCATTCACCCTGCAACCCCAAC No data
Right 934663433 2:96154959-96154981 GTTCTCTGCCCCTGGATTGCTGG No data
934663421_934663433 22 Left 934663421 2:96154914-96154936 CCCCATTCACCCTGCAACCCCAA No data
Right 934663433 2:96154959-96154981 GTTCTCTGCCCCTGGATTGCTGG No data
934663429_934663433 -4 Left 934663429 2:96154940-96154962 CCACACCTCCGCTCTTGCTGTTC No data
Right 934663433 2:96154959-96154981 GTTCTCTGCCCCTGGATTGCTGG No data
934663423_934663433 20 Left 934663423 2:96154916-96154938 CCATTCACCCTGCAACCCCAACT No data
Right 934663433 2:96154959-96154981 GTTCTCTGCCCCTGGATTGCTGG No data
934663419_934663433 30 Left 934663419 2:96154906-96154928 CCAACGACCCCCATTCACCCTGC No data
Right 934663433 2:96154959-96154981 GTTCTCTGCCCCTGGATTGCTGG No data
934663425_934663433 12 Left 934663425 2:96154924-96154946 CCTGCAACCCCAACTTCCACACC No data
Right 934663433 2:96154959-96154981 GTTCTCTGCCCCTGGATTGCTGG No data
934663426_934663433 5 Left 934663426 2:96154931-96154953 CCCCAACTTCCACACCTCCGCTC No data
Right 934663433 2:96154959-96154981 GTTCTCTGCCCCTGGATTGCTGG No data
934663428_934663433 3 Left 934663428 2:96154933-96154955 CCAACTTCCACACCTCCGCTCTT No data
Right 934663433 2:96154959-96154981 GTTCTCTGCCCCTGGATTGCTGG No data
934663430_934663433 -9 Left 934663430 2:96154945-96154967 CCTCCGCTCTTGCTGTTCTCTGC No data
Right 934663433 2:96154959-96154981 GTTCTCTGCCCCTGGATTGCTGG No data
934663427_934663433 4 Left 934663427 2:96154932-96154954 CCCAACTTCCACACCTCCGCTCT No data
Right 934663433 2:96154959-96154981 GTTCTCTGCCCCTGGATTGCTGG No data
934663420_934663433 23 Left 934663420 2:96154913-96154935 CCCCCATTCACCCTGCAACCCCA No data
Right 934663433 2:96154959-96154981 GTTCTCTGCCCCTGGATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934663433 Original CRISPR GTTCTCTGCCCCTGGATTGC TGG Intergenic
No off target data available for this crispr