ID: 934663437

View in Genome Browser
Species Human (GRCh38)
Location 2:96154976-96154998
Sequence TGCTGGAGCCGCCTCTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934663426_934663437 22 Left 934663426 2:96154931-96154953 CCCCAACTTCCACACCTCCGCTC No data
Right 934663437 2:96154976-96154998 TGCTGGAGCCGCCTCTTCTGTGG No data
934663431_934663437 5 Left 934663431 2:96154948-96154970 CCGCTCTTGCTGTTCTCTGCCCC No data
Right 934663437 2:96154976-96154998 TGCTGGAGCCGCCTCTTCTGTGG No data
934663429_934663437 13 Left 934663429 2:96154940-96154962 CCACACCTCCGCTCTTGCTGTTC No data
Right 934663437 2:96154976-96154998 TGCTGGAGCCGCCTCTTCTGTGG No data
934663428_934663437 20 Left 934663428 2:96154933-96154955 CCAACTTCCACACCTCCGCTCTT No data
Right 934663437 2:96154976-96154998 TGCTGGAGCCGCCTCTTCTGTGG No data
934663425_934663437 29 Left 934663425 2:96154924-96154946 CCTGCAACCCCAACTTCCACACC No data
Right 934663437 2:96154976-96154998 TGCTGGAGCCGCCTCTTCTGTGG No data
934663427_934663437 21 Left 934663427 2:96154932-96154954 CCCAACTTCCACACCTCCGCTCT No data
Right 934663437 2:96154976-96154998 TGCTGGAGCCGCCTCTTCTGTGG No data
934663430_934663437 8 Left 934663430 2:96154945-96154967 CCTCCGCTCTTGCTGTTCTCTGC No data
Right 934663437 2:96154976-96154998 TGCTGGAGCCGCCTCTTCTGTGG No data
934663424_934663437 30 Left 934663424 2:96154923-96154945 CCCTGCAACCCCAACTTCCACAC No data
Right 934663437 2:96154976-96154998 TGCTGGAGCCGCCTCTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934663437 Original CRISPR TGCTGGAGCCGCCTCTTCTG TGG Intergenic
No off target data available for this crispr