ID: 934667259

View in Genome Browser
Species Human (GRCh38)
Location 2:96181158-96181180
Sequence CTACTGTTCTAGATGAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934667256_934667259 30 Left 934667256 2:96181105-96181127 CCACTGCTCTACATTCTATTATA No data
Right 934667259 2:96181158-96181180 CTACTGTTCTAGATGAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934667259 Original CRISPR CTACTGTTCTAGATGAAAAG TGG Intergenic
No off target data available for this crispr