ID: 934667786

View in Genome Browser
Species Human (GRCh38)
Location 2:96185411-96185433
Sequence CCTTTTTTCTGGAGTCTTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 1, 2: 2, 3: 34, 4: 356}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934667786 Original CRISPR CCTTTTTTCTGGAGTCTTGA GGG (reversed) Exonic
901189246 1:7395956-7395978 CTTTTTTGGTGGAGTCTTTAGGG + Intronic
901557975 1:10046604-10046626 CCTTGATTCTGGTCTCTTGAAGG + Intronic
902741312 1:18440466-18440488 CTTATTTTCTGTATTCTTGATGG + Intergenic
903484588 1:23680234-23680256 GCTTTTTTCTCCAATCTTGATGG - Intergenic
904506868 1:30964066-30964088 CCTATTTTCTAGAATCTAGATGG + Intronic
904850193 1:33453542-33453564 GCATTCTTCTGGAGGCTTGAGGG - Intergenic
904890537 1:33776322-33776344 CCTCTTTACTGCAGTCTTGAGGG - Intronic
906119815 1:43381977-43381999 CCTTTTCTGTTCAGTCTTGAGGG - Intergenic
906441523 1:45850084-45850106 CCTTTTATCTGCAGTCTTGCCGG + Intronic
906721388 1:48007634-48007656 CCTTCTTTGTGGACTCTTGCAGG + Intergenic
907908137 1:58803370-58803392 CCTTTTTACTGGAATCGGGAGGG + Intergenic
908617906 1:65943879-65943901 AATTTTTTGTGGAGTCTTTAGGG + Intronic
908968866 1:69800629-69800651 CATTTTTTGAGGAGTCTTTAGGG + Intronic
909526821 1:76634149-76634171 CTATTTTTCTGAAGTCTTCAAGG - Exonic
910105715 1:83629241-83629263 AGTGTTTTCTGGAGGCTTGAAGG + Intergenic
911646142 1:100338889-100338911 CATTTTTTCTGGCATTTTGATGG + Intergenic
912557035 1:110523946-110523968 CCTTTCTTTTGGATTCTTGGGGG + Intergenic
913192135 1:116421812-116421834 ACTTTTTTCTGGAGGCTCTAGGG - Intergenic
913295690 1:117317668-117317690 CCTTTTGTCTGTAGTCAGGAGGG - Intergenic
913326873 1:117635251-117635273 CCTTTGTTCTGGTGTCCTGAGGG + Intergenic
913599929 1:120413394-120413416 GCTTTTTTCTTGTTTCTTGATGG + Intergenic
914087129 1:144463269-144463291 GCTTTTTTCTTGTTTCTTGAGGG - Intergenic
914311479 1:146470933-146470955 GCTTTTTTCTTGTTTCTTGACGG + Intergenic
914590937 1:149105165-149105187 GCTTTTTTCTTGTTTCTTGAGGG - Intergenic
915008586 1:152663714-152663736 CCTTTTACCTGGAGTTTTCATGG + Intronic
916837564 1:168563642-168563664 GCTTTTTGCAGGAGTCTTTAGGG + Intergenic
919791725 1:201295362-201295384 GCTTTTTTCCTGATTCTTGATGG + Intronic
921210829 1:212896232-212896254 CCTTATTTCAGGAATCTTCAAGG - Exonic
921489362 1:215755566-215755588 TCTTTTTCCTGGTGTCTAGAAGG - Intronic
923853904 1:237825551-237825573 GTTTTTTTCTGGAGTTTTCATGG - Intronic
1063307887 10:4922617-4922639 CCTTTCTTCTTCAGTCTTGCTGG - Intronic
1065135011 10:22659281-22659303 CCTTTTGTCTGTAGTCCTTATGG - Intronic
1066462801 10:35626605-35626627 TCATTTTCTTGGAGTCTTGATGG + Intergenic
1067533288 10:47090142-47090164 CCTTTGTTTTGGAGCCTTGTAGG - Intergenic
1068833586 10:61526174-61526196 GATTTTTTGTGGAGTCTTTAGGG + Intergenic
1069311849 10:67047199-67047221 CATTTTTTCTGGAGCCTTATGGG + Intronic
1070477362 10:76843121-76843143 TCTTTTTTATTGAGTGTTGAGGG + Intergenic
1070895916 10:79982845-79982867 GCGCTTTTCTTGAGTCTTGAAGG - Intergenic
1070970201 10:80558907-80558929 CCTTGTTTCTGAGGTCATGAAGG + Intronic
1071383466 10:85095835-85095857 GCTTTTTGGTGGAGTCTTTAGGG - Intergenic
1072040023 10:91598015-91598037 CCTTTTTTCAGGGGTTTTCAGGG - Intergenic
1073255392 10:102147533-102147555 CCCTTTTCCTGGATTGTTGAAGG + Intronic
1074615944 10:115068250-115068272 CTTTTTATCGGGAGACTTGAGGG - Intergenic
1079776850 11:24542407-24542429 CCCTTTTTCTTGTGTCTTAAGGG - Intronic
1079972321 11:27050727-27050749 AGTTTTTTCTGCAGTCTTTAGGG + Intronic
1080724385 11:34881091-34881113 CCTGTTTTCTGGATTCTTGGCGG - Intronic
1081138089 11:39464193-39464215 CCATTTTTCTGCATCCTTGATGG - Intergenic
1081451575 11:43175673-43175695 CCTTTTTTCTGGAGATGTAATGG - Intergenic
1082017064 11:47497722-47497744 ACTTGTTTCTAGAGTCTTGGGGG + Intronic
1082571592 11:54747113-54747135 CGGTTTTTGTGGAATCTTGAAGG - Intergenic
1083402093 11:62430600-62430622 CATTCTTTCTGGAGTCTCCAGGG + Intergenic
1085802912 11:79608043-79608065 CAATTTTTGTGGAGTCTTTAAGG + Intergenic
1087165508 11:94998769-94998791 CCTCTTGGCTGGAGTCTGGAGGG - Exonic
1089090659 11:115872110-115872132 TCTTTTCTCTTGAGTCTTGGAGG + Intergenic
1091105192 11:132912142-132912164 TTTTTTTATTGGAGTCTTGAAGG - Intronic
1091190359 11:133689195-133689217 CTCTTTTTCTGGTGTCTTAAGGG - Intergenic
1091451647 12:575885-575907 CCTTTTCTCAGCAGTCCTGAGGG + Intronic
1092120341 12:6039191-6039213 GCTTTCTTCTGAAGTCTTCAGGG - Intronic
1092980431 12:13789340-13789362 CCTTTTTGCTGGAATGTGGAAGG - Intronic
1093516347 12:19990962-19990984 CATTTCTTCTGGAGGCTTGAGGG - Intergenic
1094759099 12:33508825-33508847 AGTTTTTGATGGAGTCTTGAGGG - Intergenic
1095739908 12:45595384-45595406 TCATTTTTCTGGAGGCTTTAGGG + Intergenic
1095949071 12:47771967-47771989 CCTTGTTTCTGGAGGCTCTAGGG - Intronic
1096791619 12:54048415-54048437 CCCTTTTTCTGGAGTTTTTAAGG - Intronic
1096900502 12:54874664-54874686 GCTTTTTGGTGGAGTCTTTAGGG - Intergenic
1097602857 12:61715734-61715756 TTTTTTTTGTAGAGTCTTGAGGG - Intronic
1097777686 12:63667994-63668016 GCGCTTTTCTTGAGTCTTGAAGG - Intronic
1099027777 12:77487286-77487308 CCTTGTTGTTGGAGTCTTAAAGG - Intergenic
1100053609 12:90482123-90482145 CCTTGTTTCTGGGTTCTTTATGG + Intergenic
1100128941 12:91465908-91465930 TTTTTTTTCTGGAATCTTTAGGG - Intergenic
1101054551 12:100898904-100898926 GCATTCTTCTGGAGTCTTGATGG + Intronic
1101075807 12:101128826-101128848 ACTTTTTTCCCCAGTCTTGATGG + Intergenic
1101876668 12:108600597-108600619 CGTTCATTCTGGAGTCTTGGGGG + Intergenic
1101934139 12:109042850-109042872 GCTTTTTTCTGGACTCTTTAAGG - Intronic
1102584308 12:113912426-113912448 CCTGTTTTCTTGGGTCTAGAAGG - Intronic
1103128977 12:118450336-118450358 TCCCTTTTATGGAGTCTTGAAGG + Intergenic
1103351162 12:120284696-120284718 GCTTTATTCTGGTGTCATGAAGG - Intergenic
1104539723 12:129652664-129652686 CATTTTTTCTGGAGTCTCTAGGG - Intronic
1104668398 12:130663796-130663818 CCATTTTTATGTTGTCTTGAGGG - Intronic
1105541336 13:21319794-21319816 CTTTTTTTCTAGCTTCTTGAAGG - Intergenic
1108970970 13:56376249-56376271 CATTTCTTCTGGAGGCTTCAGGG - Intergenic
1109617890 13:64860930-64860952 CCTTTTTGGATGAGTCTTGAGGG + Intergenic
1109864898 13:68250465-68250487 CTTTTTTTCTTGAGTCATGCAGG + Intergenic
1109938690 13:69329500-69329522 CCTCTGTTCTGGAATCTTTATGG + Intergenic
1113950500 13:114068940-114068962 CCTTTTTTCTGTATTTTTCAAGG - Intronic
1114228590 14:20760603-20760625 CCTATTTTCAGGAGCTTTGATGG - Intergenic
1114332097 14:21647291-21647313 CCATTTTTATGCAGTCTTAATGG - Intergenic
1115005043 14:28472116-28472138 CCACTTTTCTGTATTCTTGAAGG + Intergenic
1115841823 14:37480797-37480819 GTTTTTTTGTGGAGTCTTCAGGG - Intronic
1116026052 14:39516793-39516815 GCTTTTTGCTGGAGTCTTTAGGG - Intergenic
1116532027 14:45983725-45983747 CATTTTTTGTGGAGTATTTAGGG + Intergenic
1117194425 14:53325364-53325386 TCTTTTTTCAGGAGGCTTGGTGG + Intergenic
1118099985 14:62587123-62587145 CATTTTACCTTGAGTCTTGAGGG + Intergenic
1119755677 14:77117489-77117511 CCTGTTTTCTGGAGCCTTGGAGG + Intronic
1119948697 14:78722125-78722147 CGGTTATTCTAGAGTCTTGAAGG + Intronic
1120307632 14:82790604-82790626 CCTTTTCCCTGGAGTAGTGAGGG + Intergenic
1122261954 14:100528803-100528825 ACTTCTTTCTGGAGGCTGGAGGG - Intronic
1123143529 14:106106231-106106253 CTTTTTTGGTGGAGTCTTTAGGG + Intergenic
1125555058 15:40577850-40577872 CTTTTTTTGTGGATTCTTTAGGG + Intergenic
1125863839 15:43024241-43024263 CCTTTTTCCTTGAGTATTGTTGG - Intronic
1126859232 15:52868304-52868326 CCCTATTTCTGAAATCTTGATGG + Intergenic
1126861541 15:52888410-52888432 AGTTTTTTATGGAGTCTTTAGGG - Intergenic
1127176711 15:56365734-56365756 ACTTTTTTCTGGAGACTGGCTGG + Intronic
1127526161 15:59793835-59793857 TTTTTTTTCTGGGGTCTTCACGG - Intergenic
1127606958 15:60596002-60596024 CATTTTTGCAGGAGTCTAGACGG + Intronic
1130135642 15:81179608-81179630 ACTTCTTTCTGGAGGCTAGAAGG + Intronic
1130749429 15:86694487-86694509 GCTTTTTGATGGAGTCTTTAGGG + Intronic
1132849576 16:2018961-2018983 CCATTTAAGTGGAGTCTTGAAGG + Intronic
1134800462 16:17079530-17079552 CCTGTTCTTTAGAGTCTTGAAGG + Intergenic
1136682746 16:31977521-31977543 CCTGCCTTCTGGGGTCTTGAGGG + Intergenic
1136783384 16:32921087-32921109 CCTGCCTTCTGGGGTCTTGAGGG + Intergenic
1137330492 16:47490545-47490567 CCTCTTTTCTGGAGGCTCCAGGG + Intronic
1137379968 16:47988265-47988287 CTTTTTTGGTGGAGTCTTTAGGG - Intergenic
1138263905 16:55645574-55645596 CCTCTGTTCTGGGGTATTGATGG + Intergenic
1138438369 16:57019661-57019683 CCTGTTGTCTGGATTGTTGATGG - Intronic
1141060760 16:80866711-80866733 GCTTTTTGGCGGAGTCTTGAGGG - Intergenic
1203086035 16_KI270728v1_random:1185071-1185093 CCTGCCTTCTGGGGTCTTGAGGG + Intergenic
1143716821 17:8778624-8778646 CCTTTTTTCTGGGGGGTTGGGGG + Intergenic
1143967859 17:10769772-10769794 GTTTCTTTCTGGTGTCTTGATGG + Intergenic
1146002824 17:29141383-29141405 CCTTTTTTCTGCAGAGCTGACGG - Intronic
1146041691 17:29460633-29460655 GCTTTATTCTGAAGTCTTCAGGG + Intronic
1147476247 17:40714476-40714498 CTTATTTTCTGGAGTGTTGGGGG + Intergenic
1147515117 17:41108792-41108814 CCTTTGTTCTGAATTCTTTAAGG - Intergenic
1148866188 17:50629929-50629951 ACCTTTTCCTGGAGTCTTGGGGG - Intergenic
1149470258 17:56910633-56910655 CCTTTGGTCTGGAGTCGTGTGGG - Intronic
1149631474 17:58128352-58128374 CCTTATCTCTGGAGACTTTAAGG + Intergenic
1150060907 17:62067442-62067464 CCTCTCTTCAGGAATCTTGAGGG - Intergenic
1150182975 17:63146294-63146316 GTATTTTTCTGGAGTCTTTAGGG + Intronic
1150234230 17:63579703-63579725 CTTGTTTTCTGTAGTCTTTATGG + Intronic
1150636599 17:66917594-66917616 GCCTTTTTTTGGACTCTTGAAGG - Intergenic
1151317761 17:73334624-73334646 TTTTGTTTCTGGAGTCTAGATGG + Exonic
1152296613 17:79470868-79470890 CCTCTCTTCTGGAGTCTTCCGGG + Intronic
1152708728 17:81859718-81859740 ACTTTTGTCTGTAGTCTTAAAGG - Intronic
1152842395 17:82578615-82578637 CATATTTTCTGGAGTCTTGTTGG + Intronic
1153056142 18:948612-948634 CCTTTTCTCTGTAGCCTTGCTGG + Intergenic
1155115138 18:22757802-22757824 CCTTTTTGGTGGAATCTTTAGGG - Intergenic
1155393418 18:25361297-25361319 CCTTTTTTCTGCACTCTAGCAGG - Intergenic
1155430673 18:25753114-25753136 CCTTTTTAGTGGAGTGTTTATGG - Intergenic
1155762205 18:29582515-29582537 CATTTTTTATGGATTCTTGAAGG - Intergenic
1155992994 18:32300181-32300203 CCTACTCTCTGGAGTCTTTAGGG - Intronic
1157463071 18:47918984-47919006 CTGTTTTACTGGGGTCTTGATGG - Intronic
1157555775 18:48612199-48612221 CATTCTCGCTGGAGTCTTGAAGG + Intronic
1158848556 18:61470480-61470502 CCTTTTGTCTGGACCCTGGATGG - Intronic
1159933508 18:74339742-74339764 GTTTTTTTGTGGAGTCTTTAGGG - Intronic
1160905117 19:1448285-1448307 ATTTTTTTCTGGAGGCTGGAAGG - Intronic
1164473566 19:28555493-28555515 CCTTTTATCTGTGATCTTGAGGG - Intergenic
1164734751 19:30532619-30532641 CCCTTTTGCTGGAATCATGAAGG - Intronic
1166263051 19:41656296-41656318 GCTTTTTGAAGGAGTCTTGATGG - Intronic
1166530716 19:43541701-43541723 CGTTCCTTCTGGAGGCTTGAGGG - Intergenic
926920244 2:17933109-17933131 TCTTTTTTCAGTAGACTTGATGG + Intronic
927516604 2:23675220-23675242 CCTTTTTGCTGGAGGCAGGAGGG + Intronic
929254680 2:39797106-39797128 CATTGTTTCTGGAGTCATGGTGG + Intergenic
930758057 2:54998907-54998929 CCTTTATTCTGCAGTATAGAAGG - Intronic
931101444 2:59006087-59006109 ACTATTTTCTGCAGTCTTCAAGG + Intergenic
932649166 2:73537057-73537079 CCTTTTGTGTGGAATCTTCACGG - Intronic
933742137 2:85542390-85542412 GCATTTTTCTGGATTTTTGATGG + Intronic
933875769 2:86620458-86620480 CCTTTCTTCAGGTGACTTGATGG - Exonic
934667786 2:96185411-96185433 CCTTTTTTCTGGAGTCTTGAGGG - Exonic
934938976 2:98486135-98486157 CTTTTTTTCTGGATACTTCATGG + Intronic
936262820 2:110976829-110976851 TGTTTTTCCTGGAGTCTTAATGG - Intronic
936858480 2:116987880-116987902 CCCTTTTTTTGGAGTTGTGATGG - Intergenic
937498916 2:122456187-122456209 GCTTTTTTGTGGAATCTTTAGGG - Intergenic
937530654 2:122823310-122823332 CCTTCTTTCTGGAGGCTCTAGGG - Intergenic
937573091 2:123387767-123387789 GCTTTTTTGGGGAGTCTTTAGGG - Intergenic
937738317 2:125318628-125318650 TTTTTTTGCTGGAGTCTTTAGGG + Intergenic
938231283 2:129662068-129662090 CCTTTTGTCTTTAGTCTTGCAGG - Intergenic
938236976 2:129713065-129713087 CATTTTTCCAGGAGACTTGAAGG - Intergenic
938752742 2:134349708-134349730 CCTATTTTTAGTAGTCTTGAAGG + Intronic
939125183 2:138169388-138169410 CCTTTTTGGTGGAGTCTTTAGGG - Intergenic
939507991 2:143072593-143072615 CCTTTTTTCTTGGGTTTTGGGGG + Intergenic
941137103 2:161732130-161732152 CCTGTTTTTTGGAGTTTTTATGG + Intronic
941139956 2:161767924-161767946 CCTTTTTTCTGAGGTTTTGGGGG - Intronic
941778427 2:169418050-169418072 TCTCTTTTCTGGAGACTTAAAGG - Intergenic
941858956 2:170258815-170258837 CCTTTTAGGTGGAGTCTTTAAGG - Intronic
943188862 2:184650559-184650581 GCTTTTTGGTGGAGTCTTTAGGG - Intronic
943264726 2:185714175-185714197 CCTTTTCTCTGTACCCTTGAGGG + Intergenic
943679523 2:190753223-190753245 CATTTTTTCTGGAGTCTTGAGGG + Intergenic
943959919 2:194251120-194251142 GTTTTTTTCTGGAGTTTTTATGG + Intergenic
944422209 2:199543674-199543696 ACTTTTTTCTGGAGTTCTCAAGG - Intergenic
944935699 2:204565084-204565106 CCTTGTTTCTGTAGGATTGAGGG + Intronic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
947873465 2:233452842-233452864 CCATTTTTCTGGAGTGGTGACGG + Intronic
947910962 2:233800412-233800434 CCTGCTGTCTGGAGTGTTGAGGG + Intronic
947926097 2:233923924-233923946 CCCTTATTCTGAAGTCCTGATGG - Intronic
1169854457 20:10088205-10088227 CTTTTTCTCTGGAGTCTTTCTGG - Intergenic
1170902285 20:20476585-20476607 TTTTTTTTCTGGAGGCTTTATGG - Intronic
1173894907 20:46543346-46543368 TTTTTTTTTTGGAGTCTTGCTGG + Intronic
1174281908 20:49445667-49445689 CCTGTTTTCAGGGGTCTTAAGGG - Intronic
1175186139 20:57180627-57180649 CTTTTATGCTGGACTCTTGAAGG - Intronic
1176361641 21:6001711-6001733 CCTTATTTCTGGAGGGATGAAGG + Intergenic
1176722998 21:10407340-10407362 CATTTTTTCTTGAGTCTGGTGGG + Intergenic
1177454703 21:21321822-21321844 CTTTTTCTCTGAAGTCTTGACGG - Intronic
1177583508 21:23058994-23059016 CTTCTTTTCTGGAGGCTTTAGGG - Intergenic
1177658456 21:24050674-24050696 CCTTTTTTTTTGAGTTTTAAAGG - Intergenic
1178184439 21:30203864-30203886 CTTTTTTTTGAGAGTCTTGAGGG - Intergenic
1178551953 21:33548021-33548043 CCTTTTTTCTGTAGTCTTAATGG + Intronic
1179761877 21:43536839-43536861 CCTTATTTCTGGAGGGATGAAGG - Intronic
1180304156 22:11060076-11060098 CATTTTTTCTTGAGTCTGGTGGG + Intergenic
1181295469 22:21834965-21834987 CCTTTTCTCTTGAGCCTTGATGG - Intronic
1182249164 22:28985884-28985906 CATTCTTTCTGGAAGCTTGAGGG + Intronic
949633749 3:5959284-5959306 GCTTTTTACTGGAGCCTTTAGGG + Intergenic
950123166 3:10495237-10495259 CCTTTTTCCTGGAGGGTTGGGGG + Intronic
950404980 3:12798561-12798583 CCTGTTTTCCGGAGGCTTGGAGG + Intronic
951139043 3:19139805-19139827 CCCAGTTTATGGAGTCTTGAGGG + Intergenic
951717237 3:25663319-25663341 ACATTTTTCTGGACTTTTGACGG - Intronic
954133960 3:48573547-48573569 CCTTTTCTCTAGGGTCTTGCTGG - Exonic
955119240 3:56039248-56039270 CTTTTTTACTGGAGTCTTTAGGG - Intronic
956224583 3:66942541-66942563 AGTTTTTTGTGGAGTCTTTAGGG - Intergenic
956561224 3:70577269-70577291 CCTTTTTTCTTTCTTCTTGAAGG + Intergenic
957174035 3:76781300-76781322 TATTTTTTATGGAGTCTTTAGGG + Intronic
957688990 3:83543210-83543232 GCTTTTTGGTGGAGTCTTTAGGG + Intergenic
957991145 3:87628773-87628795 GCTTTTTGGTGGAGTCTTCAGGG - Intergenic
958588979 3:96129203-96129225 CTTTTTTGGTGGAGTCTTTAGGG - Intergenic
958601004 3:96297432-96297454 CATTTTTTCTTGATTCTTTAGGG - Intergenic
961352110 3:126310713-126310735 CCTTTTTTAAGAAGTCTTAATGG + Intergenic
962149000 3:132872739-132872761 CCATTTTTCAGGAGTTTGGATGG + Intergenic
964816386 3:160721520-160721542 CCTTTTTTCAGCATTCTTAAAGG + Intergenic
965049754 3:163630538-163630560 CCTTCTTTCTGCAGCCTTGCTGG + Intergenic
965322426 3:167266192-167266214 CCTTTTTTCTCAACTTTTGAAGG + Intronic
966086528 3:176074406-176074428 AGTTTTTTGTGGAGTCTTTAGGG - Intergenic
966518000 3:180840824-180840846 CATTTTTCGTGGAGTCTTTAGGG + Intronic
966666818 3:182480768-182480790 TCTCTTTCCTGGAGTTTTGAGGG - Intergenic
967896689 3:194401204-194401226 CCTTTTTTATGGTGTCTTGAAGG - Intergenic
968455092 4:693566-693588 CCTTTAATCTGGAGTCTAGGGGG + Intergenic
970841697 4:20479310-20479332 CCTTTATTCAGTAGTCTTGTGGG + Intronic
971051854 4:22870746-22870768 CCAGTTTTCTGCAATCTTGAAGG - Intergenic
973680237 4:53309900-53309922 GCTATTTTCTGGACTTTTGAAGG - Intronic
974254679 4:59433449-59433471 CTTTTTTGGTGGAGTCTTTAGGG + Intergenic
974517806 4:62939452-62939474 CCTTTTCTCTGCAGCCTTGATGG + Intergenic
974633284 4:64524228-64524250 AGTTTTTTATGGAGTCTTTAGGG + Intergenic
974805379 4:66873043-66873065 CCTTTTGTGTGCAGTCTTGAGGG + Intergenic
974912576 4:68141070-68141092 CTTTGTTTCTAGAGTCTTTAGGG - Intergenic
975036644 4:69692624-69692646 ACATTTTTATGGAGTCTTTAAGG + Intergenic
975310862 4:72902252-72902274 TCTATTTTTTGGAGTCTTGGGGG + Intergenic
975586797 4:75958176-75958198 CCTTTTCTTTGGAGTTATGAGGG - Intronic
976459210 4:85288410-85288432 CCTTTTTTATGGAGGCTTTAGGG - Intergenic
976886719 4:89994203-89994225 ACTTTTTTATGGAGTCTAAAAGG + Intergenic
977233906 4:94484033-94484055 CCTTGTTTCTGGAGACATGCAGG - Intronic
977763639 4:100771407-100771429 TTTTTTTTGTGGAGTCTTTAGGG - Intronic
978652698 4:111026536-111026558 CCTTTTTTGTGGAGGTTTGGGGG + Intergenic
979405166 4:120301305-120301327 GCTTTTTAGTGGAGTCTTTAGGG - Intergenic
979691836 4:123567651-123567673 CCTTTTTGCGTGAGTCTTTAGGG + Intergenic
979719502 4:123882422-123882444 ATTTTTTTCTGGAGGCTTGATGG - Intergenic
981265583 4:142779421-142779443 CCTTTGGTCTGTACTCTTGATGG - Intronic
981511586 4:145564245-145564267 CCCTTGTTCTGGATTGTTGATGG - Intergenic
983104286 4:163666723-163666745 CCTATTTTCAGGAGACTTCAAGG + Intronic
985371499 4:189289950-189289972 CCTTTTTCCTGGGGTTTTTAAGG - Intergenic
985626326 5:990476-990498 CCTTTTCTCTGGAGGCTGGCAGG + Intergenic
985751565 5:1681637-1681659 ACTTTTTTCAGGCCTCTTGATGG + Intergenic
985863108 5:2489926-2489948 CCTTTATTTTGGAGTGTAGAAGG - Intergenic
986879266 5:12150080-12150102 CTTTTTTGGTGGAGTCTTTAGGG + Intergenic
986973655 5:13369368-13369390 CTTTTTTTGTGGAGTTTTTAGGG - Intergenic
987419714 5:17704917-17704939 CCTCTTTTCTGTAGGCATGATGG + Intergenic
988362931 5:30258804-30258826 CCTAATTTCTCTAGTCTTGATGG + Intergenic
988417910 5:30969569-30969591 CCTTTTTTCTGCATTCCTTAAGG + Intergenic
988692439 5:33585992-33586014 CCATTTTACAGGAGTCTAGAAGG + Intronic
988873800 5:35421032-35421054 TTTTTTTTTTGGAGTCTTTAGGG + Intergenic
989299930 5:39878785-39878807 ATTTCTTTCTGGAGTCTTTAGGG - Intergenic
989486975 5:42002109-42002131 CCTTTTTTGTCTAGTCTTTAGGG + Intergenic
989766918 5:45098023-45098045 CCTTTTTTCTGGAGTGGAGCTGG + Intergenic
991919785 5:71644487-71644509 TCTTTTTTCTGATGTCTTGGAGG - Intronic
992068798 5:73130578-73130600 CCTTTTCTCTGGGGCCTGGAGGG + Intronic
992646282 5:78814535-78814557 TCTTTTTTTTGAAGTCTTCAGGG + Intronic
993138664 5:84002533-84002555 GCTTTTTGGTGGAGTCTTTAGGG - Intronic
993196874 5:84760374-84760396 AGTTTTTTGTGGAGTCTTTAGGG + Intergenic
993918819 5:93774283-93774305 CCTTTCATCTGAATTCTTGAAGG - Intronic
995375221 5:111466447-111466469 GCTTTTTGCAGGAGTCTTTAGGG - Intronic
996364595 5:122687693-122687715 CCGTTTTTATGGAGTCTTTGGGG - Intergenic
997176182 5:131780366-131780388 CCTTTTTCCTCCATTCTTGAAGG - Intronic
997421532 5:133771627-133771649 TTTTTTTTGTGGAGTCTTTAGGG + Intergenic
997459990 5:134045425-134045447 CCTTCATTCTGGAGGCTTTAGGG + Intergenic
998097020 5:139401779-139401801 CCTTCTTGCTGGACTCCTGAAGG + Exonic
999057889 5:148600464-148600486 TTTTTTTTCTGGAGTATTTAGGG - Intronic
999912148 5:156214205-156214227 AGTTTTTTGTGAAGTCTTGAGGG - Intronic
1001703657 5:173725469-173725491 GCCTTTTGCTGGAGTCTTTAGGG - Intergenic
1002722967 5:181275441-181275463 CATTTTTTCTTGAGTCTGGTGGG + Intergenic
1002837289 6:875658-875680 CCTATTTTCTGTAGCCCTGATGG + Intergenic
1004248647 6:14003823-14003845 CTCTTTTTCTGGAGGCTCGAGGG + Intergenic
1004331138 6:14722543-14722565 CCATTTTGCTAGAGTTTTGATGG - Intergenic
1005671786 6:28113666-28113688 CCTGACTTCTGGAGGCTTGAAGG - Intergenic
1006687389 6:35847532-35847554 GGTTTTTGCTGGAGTCTTTAGGG - Intronic
1006723497 6:36177473-36177495 CCTTTTCTTTGGAGTATTTATGG + Intergenic
1006930011 6:37681849-37681871 CCTCCTTTCTGGAGACTTGAGGG - Intronic
1008681146 6:53873673-53873695 GGTTTTTTATGGAGTCTTTAGGG + Intronic
1010021675 6:71167559-71167581 CCTTTTTTCTATAATCTGGAAGG - Intergenic
1010182525 6:73104203-73104225 GTTTTTTTCTGGAATCTTTAGGG - Intronic
1010354512 6:74916114-74916136 CTTTTTTTCAGGAGACTTTAAGG - Intergenic
1010559889 6:77335714-77335736 AGTTTTTTATGGAGTCTTAACGG + Intergenic
1011165771 6:84444206-84444228 CCTTTTTTCAGGATACCTGAAGG - Intergenic
1011247066 6:85330736-85330758 AGTTTCTTCTGGAGGCTTGAAGG + Intergenic
1012027359 6:94013239-94013261 CATTCTTTCTGGAGTTTTTAGGG - Intergenic
1012147730 6:95707469-95707491 CCTTTTTCCAGGAATCTTCATGG + Intergenic
1012676288 6:102116841-102116863 CTTTTTTTATGGAGTCATTAGGG + Intergenic
1012701720 6:102466055-102466077 CCATTTTACTAGAGTGTTGAGGG - Intergenic
1012998286 6:105994642-105994664 CCTTTTGTCTGGAGTGTCGCGGG + Intergenic
1013985210 6:116183792-116183814 GCTTTTTTGAGGAGTCTTTAGGG + Intronic
1014203306 6:118627714-118627736 TCCCTTTTCTGGAGTCATGAGGG - Intronic
1014795875 6:125723511-125723533 TATTTTTTCTGGACCCTTGAGGG - Intergenic
1017245409 6:152218882-152218904 GCTATTTTCTTGAGTCTTGAAGG + Intronic
1017394527 6:153981554-153981576 CCTTTTCGGTGGAGTCTTTAGGG + Intergenic
1018940324 6:168305211-168305233 CATTTTGTCTGGAGTCTGCATGG + Intronic
1020504848 7:8972520-8972542 TCTTTTTGGTGGAGTCTTTAAGG + Intergenic
1021154237 7:17190196-17190218 AGTTTTTTGTGGAGTCTTTAGGG + Intergenic
1021241782 7:18210967-18210989 CCTTTCCTTTGGAGTCATGATGG + Intronic
1021787188 7:24164051-24164073 CTTTCTTTCTGGGGTCTGGAGGG - Intergenic
1022360403 7:29651066-29651088 GCGCTTTTCTTGAGTCTTGAAGG + Intergenic
1022936618 7:35185657-35185679 GCGCTTTTCTTGAGTCTTGAAGG - Intergenic
1023715759 7:43042647-43042669 CCTATTTTTTAGAGTCTTGAAGG + Intergenic
1023719185 7:43075592-43075614 CCTCTTTTCTGGACACTTCATGG + Intergenic
1024524054 7:50333121-50333143 CATTTGTTCTGGAGTCCAGAGGG - Intronic
1024715487 7:52075155-52075177 GCATTTTTCATGAGTCTTGAAGG + Intergenic
1024907082 7:54397929-54397951 CCTTCTTTCTGGAGGCTCCAGGG + Intergenic
1025164245 7:56696982-56697004 CCCTGTTTCTGGAATCTTGATGG - Intergenic
1025706034 7:63865049-63865071 CCCTGTTTCTGGAATCTTGATGG + Intergenic
1026280508 7:68918094-68918116 CCTCTTTCCTGGATCCTTGAAGG - Intergenic
1026280591 7:68918574-68918596 CCTCTTTCCTGGATCCTTGAAGG - Intergenic
1027220059 7:76208205-76208227 GCTTTCTTCTGGGGTCTTGTTGG - Intronic
1028040937 7:86053747-86053769 GCTTTTTGGTGTAGTCTTGAAGG + Intergenic
1028112353 7:86956986-86957008 CCTTGATTCTGCAGTTTTGAGGG + Intronic
1028373494 7:90119906-90119928 GCGCTTTTCTTGAGTCTTGAAGG + Intergenic
1028404480 7:90460928-90460950 CCTTTCCTCTTGAGTTTTGATGG + Intronic
1028650754 7:93148446-93148468 TCTTTTTTCTTGAGTTTAGAAGG + Intergenic
1028655566 7:93202599-93202621 TCTTTTTTGAGGAGTCTTCAGGG - Intronic
1028814847 7:95132082-95132104 GCTTTTTGGTGGAGTCTTTAGGG + Intronic
1028868759 7:95742485-95742507 GCCTTTTGCTGGAGTCTTTAGGG - Intergenic
1029617447 7:101668041-101668063 CCCTTTCTCTGGACTCTTGGTGG + Intergenic
1029963788 7:104716425-104716447 GCTTTTTGGTGGAGTCTTTAAGG - Intronic
1030020868 7:105274217-105274239 ATTTTTTTTTGGAGGCTTGAGGG - Intronic
1031489960 7:122374539-122374561 TCTTTTTTGTAGAGTCTTTAGGG - Intronic
1031578285 7:123441863-123441885 CTCTTTTTCTGGAATCTTTATGG - Intergenic
1031700914 7:124925212-124925234 GATTTTTGGTGGAGTCTTGAGGG - Intronic
1032775102 7:135104562-135104584 CCTTTTTTCTGCAACCTTGCCGG + Intronic
1032894242 7:136233292-136233314 CATTCTTTCTGGAGGCTTCAGGG - Intergenic
1032912028 7:136443627-136443649 GCTTTTTTGAGGAGTATTGAGGG - Intergenic
1033592552 7:142824012-142824034 CTTTTTTACTAGAGTCTTTAGGG + Intergenic
1035164466 7:156977299-156977321 GGTTTTTTATGGAGTCTTTAGGG + Intergenic
1035172570 7:157026594-157026616 AGTTTTTTGTGGAGTCTTCAGGG + Intergenic
1037378098 8:18253960-18253982 CCTTTTTGGTGGAGTCTTCAGGG - Intergenic
1037958654 8:23079098-23079120 GCCTTTTTGTGGAGTCTTTACGG + Intergenic
1038173354 8:25159175-25159197 TGTTTTTTCTGGAGTCTTTATGG - Intergenic
1038177727 8:25196193-25196215 CATTATTTCTGGAGGCTTTATGG + Intronic
1038576779 8:28711345-28711367 TTTTTTTTCTGGGTTCTTGAAGG + Intronic
1039135369 8:34316699-34316721 CATTTCTTCTGGAGGCTTCAGGG + Intergenic
1039209274 8:35193878-35193900 GCTTTTTGGTGGAGTCTTTAGGG + Intergenic
1040040141 8:42907919-42907941 GTTTTTTTCTGGAGTCTTTGTGG - Intronic
1041080984 8:54214645-54214667 TCTTTTTTCTCGAATCTGGATGG - Intergenic
1041312992 8:56535490-56535512 CCTTTTTGCTGGAATCATGGTGG + Intergenic
1041888615 8:62843254-62843276 CTGTTTTTCTGGAGTCTCTAGGG - Intronic
1041917914 8:63154421-63154443 CCTTTCTTCTGGAGTCTCTAGGG + Intergenic
1043542926 8:81282275-81282297 CCAGGATTCTGGAGTCTTGAAGG + Intronic
1043945304 8:86244463-86244485 TATGTTTTCTGGAGACTTGAGGG + Intronic
1044201163 8:89439765-89439787 GCTTTTTGGTGGAGTCTTTAGGG - Intergenic
1044228396 8:89745389-89745411 CGTTTTTTATCGAATCTTGAGGG + Intergenic
1046880753 8:119305617-119305639 ATTTTTTTGTGGAGTCTTTAGGG - Intergenic
1047568760 8:126074476-126074498 ATTCTTTTCTGGAGGCTTGAGGG + Intergenic
1047633428 8:126732903-126732925 TTTTTTTTCTGGAGTCTTTAGGG + Intergenic
1047902283 8:129436407-129436429 CTTTTCTTCTGGAGACTTTAGGG - Intergenic
1048060595 8:130915936-130915958 CCTTTGTTCTGGAATGTTCAAGG - Intronic
1048539004 8:135325346-135325368 CCTTGATCCTGGAGTCTTGCTGG + Intergenic
1049346537 8:142142247-142142269 ACTTTCTGCTGGAGACTTGAGGG - Intergenic
1050079570 9:1902342-1902364 CCTTTTCTCTTCAGTCTTGACGG - Intergenic
1050658660 9:7858357-7858379 TCTGTTTTCTGGAGTTTTGCTGG - Intronic
1052330390 9:27261406-27261428 GCTCCTTTCTGGAGTCATGATGG - Intergenic
1052711821 9:32066345-32066367 GCTTCTTTCTGGAGGCTTTAGGG - Intergenic
1055675807 9:78659254-78659276 GCCTGTTTGTGGAGTCTTGAGGG + Intergenic
1056328122 9:85498717-85498739 AGTTTTTTATGAAGTCTTGAGGG - Intergenic
1056411612 9:86333941-86333963 CCTTTTTTAAGAAGTCTTTAGGG - Intronic
1056626011 9:88253916-88253938 CCTTTTTCCAGGAATCTTCATGG + Intergenic
1056697271 9:88870639-88870661 ACTTTTTCCTGGATTCTTGAGGG - Intergenic
1059113583 9:111580026-111580048 AGTTTTTTCTGGAATCATGAAGG - Intronic
1059522160 9:114953450-114953472 CTTCTTTTCAGCAGTCTTGAAGG + Intergenic
1059618901 9:115981612-115981634 CCTTATTTCTGAAGTCAGGAGGG + Intergenic
1060751579 9:126173288-126173310 CCTTGGTTCTAGGGTCTTGATGG + Intergenic
1062269460 9:135701979-135702001 CCTGTTTTTCGGAGTTTTGAGGG + Intergenic
1062442556 9:136577437-136577459 CCTTCTTCCTGGAGCCTGGATGG - Intergenic
1062568265 9:137172796-137172818 CCTTTAGTCTGGAGCCTTGGGGG - Intergenic
1185969039 X:4641262-4641284 CCTTTTTTCTCTATTATTGATGG - Intergenic
1186671446 X:11771066-11771088 CCTTTGTTCTGGATCCTTCAGGG + Intronic
1187118541 X:16380314-16380336 TTTTTTTTCTGGAATCTTTAGGG - Intergenic
1187583844 X:20638249-20638271 CATTTCTTCTGGAGGCTTTAGGG - Intergenic
1188861322 X:35259984-35260006 CCATTTAACTAGAGTCTTGAAGG + Intergenic
1191872500 X:65760539-65760561 GCTTTTTTCTGGGGTTTTTATGG + Intergenic
1192084968 X:68087060-68087082 TCCTTTTTCTGGAGTTTTGGAGG - Intronic
1192607076 X:72529506-72529528 CATTTTTTCTGGAGGCTCTAGGG - Intronic
1192722818 X:73717602-73717624 GTTTTTTGATGGAGTCTTGAGGG + Intergenic
1193550224 X:82883327-82883349 GCCTTTTGGTGGAGTCTTGAGGG - Intergenic
1193670974 X:84385747-84385769 CCTTTTTTTTACAGTCTTTAAGG + Intronic
1193756309 X:85413124-85413146 CGTTTTTAGTGGAGTCTTTAGGG + Intergenic
1193945305 X:87726718-87726740 TCTTTTTTCTGGACACTTCAGGG + Intergenic
1196606331 X:117661602-117661624 CTTTTCTTCTGGAGTTTTTATGG - Intergenic
1196722488 X:118867627-118867649 CCTTGTTTCTGGCCTCTTCAGGG + Intergenic
1197390017 X:125851240-125851262 TCCTTTTTCTTGAGGCTTGATGG + Intergenic
1197535555 X:127684313-127684335 CCTTTTTTCTGGAGCCTCTAGGG + Intergenic
1201578632 Y:15487979-15488001 CTTCTTTTCTGGAGGCTTTAGGG + Intergenic