ID: 934669629

View in Genome Browser
Species Human (GRCh38)
Location 2:96202538-96202560
Sequence GATTTGCTCAGAGAACAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934669629 Original CRISPR GATTTGCTCAGAGAACAATC AGG Intronic
900084915 1:888130-888152 AATTTGCTCATACAACCATCTGG + Intergenic
901642985 1:10702448-10702470 GATTTGCTCTGAGAAGCATCTGG + Intronic
904634180 1:31866992-31867014 GATTTTTTCAGTTAACAATCTGG + Intergenic
905328759 1:37177096-37177118 AATTCACTCAGAGAACACTCAGG + Intergenic
906751766 1:48269189-48269211 GATTTGATCAGAGAAAAAAATGG - Intergenic
907010222 1:50956198-50956220 GATTTTCTTAGAGGACAATTTGG + Intronic
910205413 1:84744190-84744212 GATGTGCTTAGAGAACCACCAGG - Intergenic
911156032 1:94637722-94637744 GATGTCCTCAAAGAACAATGGGG - Intergenic
913065539 1:115250092-115250114 GACTTGCTTAGAAAACAGTCTGG - Intergenic
913081562 1:115392731-115392753 TATATGTTCAGAAAACAATCTGG - Intergenic
916127910 1:161587829-161587851 GCATTGCTCAGTGAAAAATCAGG + Intronic
916137828 1:161669659-161669681 GCATTGCTCAGTGAAGAATCAGG + Intronic
919608137 1:199711841-199711863 TATTTGCTCAGAAGTCAATCAGG - Intergenic
922623634 1:227014693-227014715 GATTTCCTTAGAGAGCAATTTGG + Intronic
923212931 1:231822158-231822180 GATTTAATCACAGAATAATCAGG + Intronic
1063056010 10:2505086-2505108 GAATTTCTCAGAAATCAATCTGG + Intergenic
1063766250 10:9144145-9144167 GTTTTGCTACTAGAACAATCTGG + Intergenic
1064436966 10:15319052-15319074 AATGTGCTCAGAGAATAACCAGG + Intronic
1064567618 10:16658400-16658422 GGTTTGACCAGAGAACAATTTGG + Intronic
1065981831 10:30905194-30905216 AATTTGTTCGGAAAACAATCTGG - Intronic
1067703340 10:48589159-48589181 GATTTGGTCAGAGCAATATCAGG - Intronic
1069253243 10:66298577-66298599 GATTTCCTGAGAGAAAATTCAGG - Intronic
1069649354 10:70033419-70033441 TAATTGCTCAGAGAGCAAGCAGG + Intergenic
1070443080 10:76465778-76465800 GATTTCCTCCGAGAACCATGAGG + Intronic
1072015636 10:91343729-91343751 GTTTTGCTCAGAGCACACTGTGG - Intergenic
1072568879 10:96641416-96641438 GATTCGCTCACAGGACAAACAGG - Intronic
1072823953 10:98586891-98586913 GGTTTGAGCACAGAACAATCTGG - Intronic
1078510677 11:11982009-11982031 GCTTTCCTCAGAGACCAACCAGG - Intronic
1079352915 11:19708101-19708123 GATTTGCACACAGACCCATCTGG + Intronic
1079743779 11:24099538-24099560 GTTTTGATCAGAGGGCAATCTGG - Intergenic
1081708169 11:45198701-45198723 GATTTGCTCAGAGGCAAAGCTGG + Intronic
1084932807 11:72570601-72570623 TATTCCCTCAGAGAAAAATCTGG + Intergenic
1084993879 11:72956076-72956098 GAAGTGCTCAGAGAACAATGGGG + Intronic
1085268866 11:75257863-75257885 GATTTGATCTGAGATCAAACAGG - Intergenic
1088826993 11:113504272-113504294 GATTTGCTCATTGAAAACTCAGG + Intergenic
1089010457 11:115127943-115127965 GACCTCCTCAGAGAACATTCAGG - Intergenic
1089579480 11:119472514-119472536 GATTTGCACAGAGGAAAGTCTGG + Intergenic
1091982049 12:4873303-4873325 AATCTCCTCAGAGAACAAACAGG + Intergenic
1093528655 12:20135455-20135477 GACCTGCACAGAGAACAGTCTGG + Intergenic
1093560562 12:20533954-20533976 GATTTGCTCAGAAAAAAGACGGG - Intronic
1093956297 12:25222748-25222770 TATTTGATCAGAAAACTATCTGG - Intronic
1094454572 12:30618290-30618312 GAACTGCTAGGAGAACAATCAGG - Intergenic
1100411182 12:94321614-94321636 GACTTGCATAGAGAACAGTCTGG + Intronic
1102599319 12:114017238-114017260 GAGTTTCTCAAAGAACTATCAGG - Intergenic
1111110456 13:83701782-83701804 AATATGATCAGAGAACAATCAGG + Intergenic
1111280828 13:86021910-86021932 GATTTTCACAGAGAACAATTAGG + Intergenic
1111383594 13:87494266-87494288 GATTTTCTCAGAAAATAATTAGG - Intergenic
1111560278 13:89935869-89935891 AATTTGCTAAGAGAATAACCAGG + Intergenic
1113782946 13:112986934-112986956 GATTTGATAAGAAAACAAGCTGG + Intronic
1115651687 14:35406628-35406650 GATTAGTTCTGAGAACAATGTGG - Intergenic
1120445237 14:84587157-84587179 GAATAGCTGAGAGAACACTCGGG + Intergenic
1120874555 14:89363407-89363429 GACTTTCCCAGAGAACATTCTGG + Intronic
1121883309 14:97519620-97519642 CATTTGCTAAGAAAGCAATCTGG - Intergenic
1121932726 14:97987798-97987820 GCTTGCCTCAAAGAACAATCTGG - Intergenic
1122172983 14:99892215-99892237 GCTTTGCTCAGAGAGCTATGAGG - Intronic
1124360324 15:29032227-29032249 GATTTGCTCAAACACCAGTCTGG + Intronic
1125147981 15:36494848-36494870 GATCTGCTCAGAGAACAATCTGG - Intergenic
1126613304 15:50551355-50551377 GAAGTGCTCAAAGAACAATAAGG - Intergenic
1128407754 15:67360488-67360510 GACTTGCTCAAAGGAGAATCAGG - Intronic
1129484733 15:75859154-75859176 AATATGCTTAGAAAACAATCTGG + Intronic
1130693507 15:86106820-86106842 GAGTTGCTCATAGAAAGATCAGG + Intergenic
1131208693 15:90474355-90474377 GATGTGCTAAGACAACTATCAGG - Intronic
1135682910 16:24473544-24473566 CCTTTGCTCAGAGGAGAATCAGG - Intergenic
1135852511 16:25977376-25977398 GATGTGCTCAGAGAACTAAAAGG - Intronic
1137573670 16:49583965-49583987 TATCTGCTCAGTGAACAAGCTGG - Intronic
1138101012 16:54252540-54252562 GATTTGCAGAGAGGGCAATCTGG + Intronic
1139262941 16:65612652-65612674 GGTTTTCTCACAGAACACTCAGG + Intergenic
1139870956 16:70108269-70108291 GATTTCTTCAGAGAACAACCAGG + Intergenic
1140375919 16:74445604-74445626 GATTTCTTCAGAGAGCAACCAGG - Intergenic
1143012332 17:3872801-3872823 GAGTTGCTGAGGGAACAATGAGG + Intronic
1145408513 17:22633192-22633214 GATTTGCTCATGGAACATGCTGG + Intergenic
1146284445 17:31565053-31565075 GATGAGCTCAGAGGAAAATCAGG - Intergenic
1148086927 17:44999367-44999389 TATTTGCACATACAACAATCTGG + Intergenic
1150188341 17:63210743-63210765 GATTTGCTCTTAAAATAATCAGG + Intronic
1154559555 18:15808184-15808206 GATTTGATCTGAAGACAATCCGG - Intergenic
1154560385 18:15819717-15819739 GATTTGATCTGAAGACAATCCGG - Intergenic
1154567053 18:15911493-15911515 GATTTTCTCTGAAGACAATCCGG - Intergenic
1154614851 18:16565809-16565831 GATTTGATCTGAAGACAATCCGG - Intergenic
1154632581 18:16809412-16809434 GATTTGATCTGAAGACAATCCGG - Intergenic
1154655311 18:17121558-17121580 GATTTGATCTGAAGACAATCCGG - Intergenic
1154702026 18:17760866-17760888 GATTTGATCTGAAGACAATCCGG - Intergenic
1154715453 18:17945259-17945281 GATTTTCTCTGAAGACAATCCGG - Intergenic
1163609750 19:18294720-18294742 GATGTGCCCAGAGAAGCATCCGG + Intergenic
1165040103 19:33063015-33063037 CACCTGCTCAGAGAACAATCTGG + Intronic
928328135 2:30336222-30336244 GAATTTCTCAGAGCACAGTCAGG + Intergenic
928653589 2:33426589-33426611 GTTTTGCTCACAGAACAATAGGG - Intergenic
929018828 2:37529973-37529995 GACTTGCTCAGAGATCACTTGGG - Intergenic
929692866 2:44088969-44088991 CACTTGCTCAGAGATCAAACTGG + Intergenic
930660676 2:54049804-54049826 GAATTGCTCAGAAAACAAGAGGG - Intronic
931036342 2:58247514-58247536 GATTTGCTGAAATAACAATTTGG + Intergenic
934669629 2:96202538-96202560 GATTTGCTCAGAGAACAATCAGG + Intronic
939266836 2:139885140-139885162 GAATTGTTCATAGAAAAATCTGG - Intergenic
939786411 2:146519101-146519123 TATTTGCTCAGGGAAGAATGTGG - Intergenic
940090365 2:149909514-149909536 GATTTGCTAAGAGAACTCACAGG + Intergenic
947982237 2:234420413-234420435 TGTTTGGTCAGAGACCAATCTGG - Intergenic
1170248081 20:14246258-14246280 GATTTGCTCTGAGGACAATCAGG + Intronic
1171388625 20:24786818-24786840 GAGCTGCTCAGAGAGCACTCGGG + Intergenic
1171774591 20:29353401-29353423 AATTTGCTCATACAACCATCTGG - Intergenic
1171816607 20:29791026-29791048 AATTTGCTCATACAACCATCTGG - Intergenic
1171901746 20:30864956-30864978 AATTTGCTCATACAACCATCTGG + Intergenic
1177766191 21:25460355-25460377 GATTTGCTAGGAGAAGAATATGG - Intergenic
1179151297 21:38810559-38810581 TACTGGCTCAGAGAACAAGCAGG + Intronic
1180320074 22:11311634-11311656 AATTTGCTCATACAACCATCTGG - Intergenic
1180335121 22:11570904-11570926 AATTTGCTCATATAACCATCTGG + Intergenic
950554641 3:13687988-13688010 GCTCTGCTTAGAGAACATTCTGG - Intergenic
951010624 3:17673961-17673983 CATTTGCTATGAGAACAAACAGG + Intronic
951033576 3:17908580-17908602 AATTAGCTCAGAGGACAAACAGG - Intronic
953239903 3:41139630-41139652 GATTTGTTCAGAGATAAGTCTGG - Intergenic
954273687 3:49528800-49528822 GAGTGGCTCAGAGAGCAATTAGG + Intronic
956058228 3:65323032-65323054 TGTTTGTTCAGAGAAAAATCAGG - Intergenic
957559262 3:81801044-81801066 GGTTTCCTCAGAAAACAATCTGG + Intergenic
957807257 3:85164612-85164634 GACTTGCTCAGAATGCAATCAGG + Intronic
958704472 3:97637060-97637082 ATTTTGCTCAGATAACAATTGGG + Intronic
960193513 3:114736454-114736476 AGATTGCTCAGAGAACATTCTGG - Intronic
960610069 3:119547685-119547707 GATTGGCTCAGAGTAGAACCGGG + Intronic
961107674 3:124256123-124256145 GATTTGCTCAGACAGGAACCTGG + Intronic
962290597 3:134133445-134133467 GTTTTGCTCAGAGAACGAATTGG - Intronic
963681672 3:148385846-148385868 GAGTTGCTCACAGAACCAACAGG - Intergenic
964462465 3:156949985-156950007 AATTTGCTTAGAAAACCATCTGG + Intronic
964850982 3:161095868-161095890 GAATTGCTGAAAGAACACTCGGG - Intronic
965053846 3:163688860-163688882 TATTTTCTTACAGAACAATCAGG - Intergenic
969073598 4:4559275-4559297 GATTTGCTGAATGAACAAACTGG - Intergenic
969474755 4:7415452-7415474 GCTGTGGTCAGAGAACAATGTGG - Intronic
971258844 4:25037905-25037927 GAGTTGCTCAGAAGACAAGCAGG + Intergenic
973110005 4:46386864-46386886 GCTCTTCTCAGAGACCAATCAGG - Intronic
975443697 4:74439352-74439374 GAGTTGCCCATAGAAGAATCAGG + Intergenic
976479473 4:85523440-85523462 GATTTGATCAAAGTATAATCAGG + Intronic
977378804 4:96243263-96243285 AATTTGCTATGAGAAAAATCTGG + Intergenic
977683693 4:99823646-99823668 GATTTGGTCAATGAACAATGTGG + Intronic
979103220 4:116649891-116649913 CATTTCCTCACTGAACAATCTGG + Intergenic
982036580 4:151352223-151352245 GATTTGTTCAGAGCAGAATTGGG + Intergenic
982250526 4:153401744-153401766 GATTTATTCAGAGAACAATTTGG + Intronic
982530634 4:156538246-156538268 GATTTGCTCATGAAACATTCAGG - Intergenic
983906249 4:173185227-173185249 GCTTTGCCCAGAGAAGACTCAGG + Intronic
985862649 5:2486191-2486213 GATTTACTCAGAAAACTATCAGG - Intergenic
986091931 5:4517332-4517354 GATTTTAGCAGAGAAAAATCTGG + Intergenic
986307962 5:6529430-6529452 GTTTGGGTCAGAGAACACTCAGG - Intergenic
987089742 5:14500210-14500232 GCTTCTCTCAGAGAACAATTTGG - Intronic
987394168 5:17406100-17406122 GTTTTGCTCATAAAACAATTGGG - Intergenic
988383393 5:30529175-30529197 GATTTGGTCAAAAAACACTCTGG - Intergenic
988534828 5:32057861-32057883 GATTTGCTGAGAAAACAGTGAGG - Exonic
992916345 5:81457178-81457200 AATGTGCTCAGAGAAAAATGGGG + Intronic
993029735 5:82691895-82691917 GAGTTGGTCATAGAACAAACTGG - Intergenic
993252632 5:85548737-85548759 CATTTGCTTAGAGAACAAAGAGG + Intergenic
993346200 5:86786178-86786200 GATTTTCTCAGAGAAGAAAATGG - Intergenic
993414542 5:87610259-87610281 GATTTAGTCAGAAAACAGTCAGG + Intergenic
994289612 5:98013023-98013045 CCTGTGCTCAGAGAACAGTCTGG - Intergenic
994824325 5:104694283-104694305 TATTTGCTGAGAGAACAGTTAGG - Intergenic
995602475 5:113812858-113812880 GAATTGCACAGAGAAAAAACTGG + Intergenic
998813492 5:145989403-145989425 GAATTGCTCTGAAAACATTCAGG - Intronic
999915401 5:156253244-156253266 CATATGCTCAGAGAAAAGTCAGG - Intronic
1000470988 5:161641654-161641676 GATTTGGTCATAGAACACCCTGG + Intronic
1005764499 6:28997600-28997622 GATTTTCAGAGAGAATAATCTGG - Intronic
1007094351 6:39204183-39204205 GATTTGCTCTGATATCTATCTGG + Intronic
1009323454 6:62319717-62319739 GATTTGCTCAGAAAATTATGAGG - Intergenic
1010357862 6:74956051-74956073 GAGTTTCTCATAGCACAATCAGG + Intergenic
1011208912 6:84933383-84933405 CATTTGCCCAGAGAGCTATCAGG + Intergenic
1011947033 6:92918373-92918395 GTTTTGCTCAGATTAAAATCAGG - Intergenic
1016393771 6:143601249-143601271 GATTTTCTCAAAGAAGATTCTGG - Intronic
1023936616 7:44744982-44745004 GATATGCAAAGAGAACCATCTGG + Intergenic
1024130139 7:46343235-46343257 GATTTTCTCAGAGGAGAATGTGG - Intergenic
1028894710 7:96028243-96028265 GATTGTCCCAGAGGACAATCTGG - Exonic
1029132203 7:98340205-98340227 GATGTGCCCAGTGAGCAATCTGG + Intronic
1032492813 7:132336705-132336727 GATTTGAACACAGAACATTCAGG + Intronic
1035178976 7:157075787-157075809 AATTTGCTTAAAGAACAATTTGG + Intergenic
1035859895 8:3016758-3016780 CATTTGCTCAGAGGAAAATAAGG - Intronic
1039025855 8:33257060-33257082 CATTGGCCTAGAGAACAATCAGG + Intergenic
1043136157 8:76528205-76528227 GTTTTCCTTAGAGAAAAATCTGG + Intergenic
1043462822 8:80478043-80478065 CATTTGCTTTGAGAACTATCTGG - Intergenic
1044195077 8:89366409-89366431 GATTTGCTCTGAGAAATAACTGG + Intergenic
1045754297 8:105523961-105523983 GACTTGCTCAGGGAGCAGTCTGG - Intronic
1056285158 9:85080077-85080099 GAGTTGCTCAGGGAGCAGTCGGG + Intergenic
1056872888 9:90301534-90301556 GCTTTGCTAATGGAACAATCAGG + Intergenic
1057945876 9:99327675-99327697 GATGTTCTCAGAGGACCATCTGG - Intergenic
1058109833 9:101020043-101020065 GATTTGTTCAGAGCACTGTCTGG + Intergenic
1058897160 9:109410393-109410415 GAGTTTATCCGAGAACAATCCGG - Exonic
1203368296 Un_KI270442v1:277386-277408 AATTTGCTCATACAACCATCTGG - Intergenic
1185592908 X:1290302-1290324 AAAGTGCTCAGAGAGCAATCAGG - Intronic
1186707947 X:12162504-12162526 CATCTGCTTATAGAACAATCTGG - Intronic
1186857329 X:13638844-13638866 GATTTGCTTGGAAAACAATGGGG + Intergenic
1187672358 X:21680769-21680791 GAAGTGCTCAAAGAACAATGGGG + Intergenic
1189306290 X:39989212-39989234 TATTTGCACAGAGAAAGATCTGG - Intergenic
1192000031 X:67140070-67140092 GATTTGCTCAGAGAACCTATAGG + Intergenic
1193727142 X:85055721-85055743 GATTTGCTAAGATAATAATGAGG - Intronic
1194928430 X:99857677-99857699 AATGTTCTCAGACAACAATCAGG - Intergenic
1201676333 Y:16588959-16588981 GAATTGAACAGAGAGCAATCTGG + Intergenic