ID: 934675784

View in Genome Browser
Species Human (GRCh38)
Location 2:96248813-96248835
Sequence GAGACAGCTGTGAGTCCGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 597
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 574}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934675784_934675787 15 Left 934675784 2:96248813-96248835 CCAGACGGACTCACAGCTGTCTC 0: 1
1: 0
2: 1
3: 21
4: 574
Right 934675787 2:96248851-96248873 TACCTGACTCTTTAGACACAGGG 0: 1
1: 0
2: 0
3: 11
4: 136
934675784_934675792 27 Left 934675784 2:96248813-96248835 CCAGACGGACTCACAGCTGTCTC 0: 1
1: 0
2: 1
3: 21
4: 574
Right 934675792 2:96248863-96248885 TAGACACAGGGTTGGCTGGAGGG 0: 1
1: 0
2: 4
3: 37
4: 549
934675784_934675789 19 Left 934675784 2:96248813-96248835 CCAGACGGACTCACAGCTGTCTC 0: 1
1: 0
2: 1
3: 21
4: 574
Right 934675789 2:96248855-96248877 TGACTCTTTAGACACAGGGTTGG 0: 1
1: 0
2: 0
3: 7
4: 144
934675784_934675786 14 Left 934675784 2:96248813-96248835 CCAGACGGACTCACAGCTGTCTC 0: 1
1: 0
2: 1
3: 21
4: 574
Right 934675786 2:96248850-96248872 TTACCTGACTCTTTAGACACAGG 0: 1
1: 0
2: 0
3: 6
4: 105
934675784_934675790 23 Left 934675784 2:96248813-96248835 CCAGACGGACTCACAGCTGTCTC 0: 1
1: 0
2: 1
3: 21
4: 574
Right 934675790 2:96248859-96248881 TCTTTAGACACAGGGTTGGCTGG 0: 1
1: 0
2: 3
3: 26
4: 179
934675784_934675793 28 Left 934675784 2:96248813-96248835 CCAGACGGACTCACAGCTGTCTC 0: 1
1: 0
2: 1
3: 21
4: 574
Right 934675793 2:96248864-96248886 AGACACAGGGTTGGCTGGAGGGG 0: 1
1: 0
2: 2
3: 35
4: 384
934675784_934675791 26 Left 934675784 2:96248813-96248835 CCAGACGGACTCACAGCTGTCTC 0: 1
1: 0
2: 1
3: 21
4: 574
Right 934675791 2:96248862-96248884 TTAGACACAGGGTTGGCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934675784 Original CRISPR GAGACAGCTGTGAGTCCGTC TGG (reversed) Exonic
900160799 1:1222516-1222538 GAGACATCTGTGTGGCCGTCAGG - Intronic
900655850 1:3756595-3756617 GAGACAGATTGGAGTCTGTCTGG + Intronic
902102175 1:14000086-14000108 AATTCAGCTGTGAATCCGTCTGG - Intergenic
902630472 1:17701640-17701662 GAGGCAGCTGTGAGCCAGGCCGG + Intergenic
905051666 1:35056734-35056756 AATTCAGCTGTGAATCCGTCTGG + Intergenic
905238352 1:36565868-36565890 GAGACAGCTGTGTGTCTGTCTGG - Intergenic
905417545 1:37814609-37814631 GAGGCAGCTGTGAGTTGGACAGG - Exonic
908567772 1:65375992-65376014 AATACAGCAGTGAATCCGTCAGG + Intronic
908929261 1:69297417-69297439 AATTCAGCTGTGAATCCGTCTGG + Intergenic
908935440 1:69370549-69370571 AATTCAGCTGTGAGTTCGTCTGG + Intergenic
908972707 1:69856650-69856672 AATTCAGCTGTGAATCCGTCTGG - Intronic
908981088 1:69960089-69960111 AATTCAGCTGTGAATCCGTCTGG + Intronic
909424565 1:75507653-75507675 AATTCAGCTGTGAGTCTGTCTGG + Intronic
909437782 1:75663680-75663702 TATTCAGCTGTGAGTCCATCTGG - Intergenic
911199929 1:95034132-95034154 GAGCTAGCTGTGAGACAGTCTGG - Intronic
912035575 1:105307853-105307875 AATTCAGCTGTGAATCCGTCTGG + Intergenic
912076147 1:105878669-105878691 GAGAATGGTGTGAATCCGTCAGG + Intergenic
915181695 1:154066979-154067001 AATTCAGCTGTGAATCCGTCTGG - Intronic
916984256 1:170173862-170173884 AATTCAGCTGTGAGTCCTTCAGG - Intergenic
917358053 1:174146786-174146808 AATTCAGCTGTGAATCCGTCTGG - Intergenic
917584613 1:176413519-176413541 AATTCAGCTGTGAATCCGTCTGG + Intergenic
917743990 1:177989570-177989592 AATTCAGCTGTGAGTCTGTCTGG - Intergenic
917997211 1:180452950-180452972 TCGTCAGCTGTGAATCCGTCTGG - Intronic
919292252 1:195647293-195647315 AATTCAGCTGTGAATCCGTCTGG + Intergenic
919485397 1:198140147-198140169 AATTCAGCTGTGAATCCGTCTGG + Intergenic
919571588 1:199255623-199255645 AATTCAGCTGTGAATCCGTCTGG + Intergenic
920581357 1:207111134-207111156 GAGACAGCTGAGAGCCAGGCAGG - Intronic
921831219 1:219729869-219729891 AATTCAGCTGTGAATCCGTCTGG + Intronic
921942812 1:220860716-220860738 AAGTCAGCTGTGAATCTGTCTGG + Intergenic
922852719 1:228747572-228747594 GAGAAACCTTTGAGTCCCTCTGG - Intergenic
923081058 1:230655702-230655724 AATTCAGCTGTGAATCCGTCTGG + Intronic
924723729 1:246647336-246647358 GAGACAGCAGGGAGCCCGTCTGG + Exonic
1063302528 10:4863998-4864020 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1063625198 10:7682502-7682524 AATTCAGCTGTGAGTCCATCAGG - Intergenic
1064792388 10:18972779-18972801 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1065173706 10:23056787-23056809 GAGACAGATTTGAGCCAGTCTGG - Intergenic
1067127318 10:43530072-43530094 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1067193666 10:44094446-44094468 AATTCAGCTGTGAGTCCGTCTGG - Intergenic
1067331787 10:45329239-45329261 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1067374766 10:45717658-45717680 GACACAGCTGTGAGCCAGTGTGG + Intergenic
1067882579 10:50059296-50059318 GACACAGCTGTGAGCCAGTGTGG + Intergenic
1067923574 10:50484433-50484455 GATTCAGCTGTGAATCCGTCTGG - Intronic
1068508534 10:57934350-57934372 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1068951948 10:62786169-62786191 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1069348638 10:67499536-67499558 AATTCAGCTGTGAATCCGTCTGG + Intronic
1070349617 10:75579458-75579480 GATTCAGCTGTGAATCCATCGGG - Intronic
1071207178 10:83294974-83294996 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1072364862 10:94699016-94699038 AATTCAGCTGTGAGTCCATCTGG - Intronic
1072778939 10:98230185-98230207 AATTCAGCTGTGAATCCGTCTGG + Intronic
1072928900 10:99643170-99643192 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1075313350 10:121432706-121432728 GAGACAACTGTGGGTCCTTAAGG + Intergenic
1076093383 10:127709529-127709551 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1076141993 10:128086686-128086708 GTGGCAGCTGTGTGTCAGTCGGG + Intergenic
1076823837 10:132957427-132957449 GAGACAGCTGTTAGTGCTCCAGG - Intergenic
1077833954 11:5907194-5907216 GATTCAGCTGTGAATCTGTCTGG + Intronic
1078663011 11:13302246-13302268 GAGAAAGCTGTGAGGGCCTCGGG + Intronic
1078732581 11:13989152-13989174 AATTCAGCTGTGAATCCGTCTGG + Intronic
1078743085 11:14086750-14086772 AATTCAGCTGTGAATCCGTCTGG + Intronic
1078812395 11:14781200-14781222 AATTCAGCTGTGACTCCGTCTGG - Intronic
1078829114 11:14962316-14962338 AATTCAGCTGTGAATCCGTCTGG - Intronic
1078952014 11:16144887-16144909 AATTCAGCTGTGAATCCGTCTGG - Intronic
1079523727 11:21359603-21359625 AAGTCAGCTGTGAATCCATCTGG + Intronic
1079563333 11:21850209-21850231 AATTCAGCTGTGAATCCGTCCGG - Intergenic
1079875366 11:25849308-25849330 GACATAACTGTGAGTCAGTCTGG - Intergenic
1079877573 11:25878763-25878785 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1079900077 11:26172314-26172336 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1079964912 11:26968517-26968539 AATTCAGCTGTGAGTCCGTCTGG - Intergenic
1079974703 11:27076795-27076817 GAGACAGCTGTGCTTCTCTCTGG - Intronic
1079988538 11:27223104-27223126 AATTCAGCTGTGAGTCCGTCTGG - Intergenic
1080033269 11:27685003-27685025 AATTCAGCTGTGAATCCGTCTGG + Intronic
1080150648 11:29048372-29048394 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1080486220 11:32709808-32709830 AATTCAGCTGTGAATCCGTCTGG + Intronic
1080977447 11:37359843-37359865 GATTCGGCTGTGAATCCGTCTGG - Intergenic
1081221935 11:40472992-40473014 AATTCAGCTGTGAGTCTGTCTGG - Intronic
1081890536 11:46538200-46538222 GAGACAGCTGTCAGCCCTTATGG + Intronic
1082174188 11:49042803-49042825 AAGTCGGCTGTGAATCCGTCTGG + Intergenic
1084361594 11:68672008-68672030 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1085536225 11:77220809-77220831 AATTCAGCTGTGAATCCGTCTGG + Intronic
1086085723 11:82952971-82952993 GATTCAGCTGTGAATTCGTCTGG + Intronic
1086297869 11:85391329-85391351 AATTCAGCTGTGAGTCCATCTGG - Intronic
1086691583 11:89793270-89793292 AAGTCAGCTGTGAATCCATCCGG - Intergenic
1086714222 11:90046383-90046405 AAGTCAGCTGTGAATCCATCTGG + Intergenic
1086790647 11:91033928-91033950 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1087003127 11:93441654-93441676 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1087911513 11:103759638-103759660 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1087916491 11:103817415-103817437 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1090315336 11:125782078-125782100 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1091224685 11:133950405-133950427 GAGACAGCGGTGCGTGTGTCAGG - Intronic
1092604757 12:10106398-10106420 AATTCAGCTGTGAATCCGTCTGG - Intronic
1092622058 12:10283084-10283106 GAGAAATCTAAGAGTCCGTCAGG + Intergenic
1093806349 12:23437805-23437827 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1094114973 12:26901344-26901366 GATTCAGCTGTGAATCCATCTGG - Intergenic
1094197516 12:27764865-27764887 GAGACAGCTGTTACTCAGGCTGG + Intronic
1094873230 12:34611110-34611132 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1095915937 12:47478581-47478603 GATTCAGCTGTGAATCCATCTGG - Intergenic
1095935554 12:47676778-47676800 AATTCAGCTGTGAATCCGTCTGG - Intronic
1097430394 12:59498337-59498359 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1097543909 12:60974653-60974675 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1097763040 12:63490734-63490756 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1098691986 12:73500637-73500659 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1098978107 12:76925528-76925550 GAGAAAGCTTTCAGTCTGTCAGG - Intergenic
1099183729 12:79495943-79495965 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1099400341 12:82195523-82195545 GATTCAGCTGTGAATCTGTCTGG - Intergenic
1099497893 12:83375319-83375341 AATACAGCTGTGAATCTGTCTGG + Intergenic
1099515580 12:83593096-83593118 AATTCAGCTGTGAGTCCATCTGG - Intergenic
1100056005 12:90510466-90510488 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1100577903 12:95909438-95909460 GAGTCGGCTGTGAATCCATCTGG - Intronic
1100749007 12:97676472-97676494 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1100966042 12:100014215-100014237 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1101459942 12:104880919-104880941 AATTCAGCTGTGAATCCGTCTGG + Intronic
1101596175 12:106166976-106166998 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1101600927 12:106209380-106209402 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1102918858 12:116776740-116776762 GAGACAGATGGGATTCAGTCTGG + Intronic
1104086598 12:125480646-125480668 AATTCAGCTGTGAATCCGTCTGG - Intronic
1104256063 12:127139908-127139930 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1104428650 12:128698441-128698463 GACACAGCTGTGATACCATCTGG - Intronic
1105789392 13:23782993-23783015 AATTCAGCTGTGAATCCGTCTGG - Intronic
1106025990 13:25955663-25955685 AATTCAGCTGTGAATCCGTCTGG - Intronic
1106952559 13:34900888-34900910 GAGAGAGCTGTAAGTCATTCAGG + Intergenic
1107492093 13:40890478-40890500 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1107613809 13:42143503-42143525 AATTCAGCTGTGAATCCGTCTGG + Intronic
1108097522 13:46919365-46919387 AAGTCAGCTGTGAATCCATCTGG + Intergenic
1108113813 13:47106151-47106173 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1108144973 13:47467077-47467099 AATTCAGCTGTGATTCCGTCTGG - Intergenic
1108218025 13:48204394-48204416 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1109801688 13:67387525-67387547 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1110020283 13:70460933-70460955 AATTCAGCTGTGACTCCGTCTGG - Intergenic
1111786509 13:92793921-92793943 AATGCAGCTGTGAATCCGTCTGG - Intronic
1111953733 13:94732787-94732809 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1112411646 13:99169275-99169297 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1112437427 13:99400705-99400727 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1112683052 13:101789084-101789106 GAGACATCTGTGAGTCACCCTGG - Intronic
1113942924 13:114027985-114028007 GAGACAGCTCTGGGTCAGGCAGG + Intronic
1114358285 14:21939698-21939720 AAGTCGGCTGTGAATCCGTCTGG + Intergenic
1114603910 14:23980340-23980362 AATTCAGCTGTGAATCCGTCTGG - Intronic
1114608920 14:24023118-24023140 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1115707799 14:36015896-36015918 GAGCCACCTGTGTGTCCGTGGGG + Intergenic
1115907173 14:38212298-38212320 GTGACAGGTGTGAGTCTGGCTGG + Exonic
1116358030 14:43956341-43956363 AATACAGCTGTGAATCCATCTGG - Intergenic
1116364789 14:44046384-44046406 GATTCAGCTGTGAATCCATCGGG + Intergenic
1116765481 14:49065336-49065358 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1117204484 14:53427297-53427319 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1117303283 14:54449145-54449167 GAGAGATCTGTGAGTCCTGCAGG - Intergenic
1117948570 14:61057724-61057746 GATTCAGCTGTGAATCCATCTGG + Intronic
1118043632 14:61943269-61943291 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1118115797 14:62775509-62775531 GAGACAGCTGTTACTCACTCTGG - Intronic
1118473302 14:66094448-66094470 GGGACAGCTCTGAGAGCGTCAGG - Intergenic
1118950406 14:70431746-70431768 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1119412468 14:74441906-74441928 TAGAAAGCTGTGAGTAGGTCTGG + Intergenic
1119699944 14:76747811-76747833 AATTCGGCTGTGAGTCCGTCTGG - Intergenic
1121575713 14:94984722-94984744 GATTCAGCTGTGAATCCATCTGG - Intergenic
1121759316 14:96430877-96430899 AATTCAGCTGTGAATCCGTCTGG + Intronic
1123176818 14:106427660-106427682 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1202906238 14_GL000194v1_random:73740-73762 AAAACAGCTGAGAGTCCGTTTGG - Intergenic
1123428913 15:20197505-20197527 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1123579819 15:21705182-21705204 GGGACAGGTGTGATTCCCTCAGG - Intergenic
1123616446 15:22147693-22147715 GGGACAGGTGTGATTCCCTCAGG - Intergenic
1126051209 15:44686941-44686963 AATTCAGCTGTGAGTCCATCTGG - Intronic
1126573012 15:50172088-50172110 AATACTGCTGTGAATCCGTCTGG - Intronic
1126656819 15:50986912-50986934 AATTCAGCTGTGAATCCGTCTGG + Intronic
1127100278 15:55557380-55557402 AATTCAGCTGTGAATCCGTCTGG - Intronic
1127335699 15:57980888-57980910 AATTCAGCTGTGAATCCGTCTGG + Intronic
1127687368 15:61361726-61361748 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1129796209 15:78378568-78378590 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1129963556 15:79712481-79712503 AATTCAGCTGTGAGTCCGTCTGG - Intergenic
1130798110 15:87232373-87232395 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1130818570 15:87467121-87467143 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1202988689 15_KI270727v1_random:439427-439449 GGGACAGGTGTGATTCCCTCAGG - Intergenic
1133952805 16:10411314-10411336 GATTCAGCTGTGAGTCTGTCTGG + Intronic
1134133052 16:11662754-11662776 GAGACAGCTGTGAGCCAGGCAGG - Intergenic
1136600245 16:31281323-31281345 AATTCAGCTGTGAATCCGTCTGG + Intronic
1136855409 16:33652236-33652258 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1137051602 16:35718386-35718408 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1137336108 16:47550820-47550842 AATTCAGGTGTGAGTCCGTCTGG + Intronic
1137808849 16:51333328-51333350 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1138151873 16:54665193-54665215 AATACAGCTGTGAATCCATCTGG - Intergenic
1141194824 16:81852549-81852571 GAGTCACCTTTGAGTCAGTCAGG + Intronic
1203116995 16_KI270728v1_random:1500717-1500739 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1143862535 17:9901463-9901485 GAGACACCTGTGAGCAGGTCAGG + Intronic
1144364812 17:14532724-14532746 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1144399421 17:14881503-14881525 AATTCAGCTGTGAGTCCATCTGG + Intergenic
1145716911 17:27032122-27032144 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1148498866 17:48073529-48073551 TAGACAGCAGTGAGTCGGCCAGG + Intronic
1149174761 17:53856297-53856319 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1152039589 17:77894308-77894330 GAGGCAGGTGTGAGCCCCTCCGG + Intergenic
1152193615 17:78903267-78903289 GGGACAGCTGTGAGCCAGCCAGG + Intronic
1153221156 18:2862825-2862847 AATACAGCTGTGAATCCATCTGG + Intronic
1153561921 18:6379921-6379943 AATTCAGCTGTGAATCCGTCTGG + Intronic
1153702969 18:7714904-7714926 AATTCGGCTGTGAGTCCGTCTGG - Intronic
1154288265 18:13081244-13081266 AATTCAGCTGTGAATCCGTCTGG + Intronic
1155385255 18:25270313-25270335 GATTCAGCTGTGAATCCATCTGG - Intronic
1156096216 18:33535423-33535445 AAGTCAGCTGTGAATCTGTCTGG - Intergenic
1156886844 18:42144897-42144919 GAATCAGCTGTGAATCCATCTGG - Intergenic
1157074043 18:44445539-44445561 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1157552049 18:48588768-48588790 GAGACAGCAGTGACTCCCGCAGG - Intronic
1158100312 18:53822443-53822465 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1158822463 18:61177425-61177447 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1159453762 18:68635536-68635558 GATTCAGCTGTGAATCCATCTGG + Intergenic
1159846868 18:73471371-73471393 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1159859394 18:73629585-73629607 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1163264662 19:16212205-16212227 AATTCAGCTGTGAGTCCGTCTGG + Intronic
1164110951 19:22158127-22158149 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1164271455 19:23676240-23676262 AATTCAGCTGTAAGTCCGTCTGG - Intronic
1164284159 19:23796553-23796575 TACACAGCTGTGAATCTGTCTGG + Intronic
1164385245 19:27766290-27766312 TAGACAGCTTTGAGTCAGCCAGG + Intergenic
1165321122 19:35085721-35085743 GAGCCAGCCGTGTGTACGTCTGG - Intergenic
1165983157 19:39743199-39743221 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1167431361 19:49456739-49456761 GAGACATCTGTGAGAAAGTCAGG - Intronic
1168209194 19:54877203-54877225 GATTCAGCTGTGAGTCTGTCTGG + Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
925036692 2:692542-692564 GAGACAGCCGTGAGAACCTCGGG - Intergenic
926941460 2:18141749-18141771 AATTCAGCTGTGAATCCGTCTGG + Intronic
926943653 2:18164817-18164839 AATTCAGCTGTGAATCCGTCTGG + Intronic
927046131 2:19280519-19280541 AATTCAGCTGTGAATCCGTCTGG + Intergenic
927402665 2:22731619-22731641 AAGTCGGCTGTGAATCCGTCTGG - Intergenic
927456631 2:23256856-23256878 GATTCACCTTTGAGTCCGTCTGG - Intergenic
927610458 2:24534046-24534068 AATTCAGCTGTGAATCCGTCTGG + Intronic
927865686 2:26585888-26585910 GGGACAGCTGTGAGTGCAGCAGG - Intronic
928766563 2:34653500-34653522 AATTCAGCTGTGAATCCGTCTGG - Intergenic
929232873 2:39577620-39577642 AATTCAGCTGTGAATCCGTCTGG + Intergenic
929398977 2:41557903-41557925 AATTCAGCTGTGAATCCGTCTGG - Intergenic
929879911 2:45826637-45826659 GAGACATCTGTGAGACAGCCGGG - Intronic
929995094 2:46820891-46820913 AATTCAGCTGTGAATCCGTCTGG + Intronic
930143468 2:47977240-47977262 AATACGGCTGTGAATCCGTCTGG - Intergenic
930437271 2:51361297-51361319 AATTCAGCTGTGAATCCGTCTGG + Intergenic
930529360 2:52571675-52571697 GCGGCTGCTGGGAGTCCGTCTGG - Intergenic
930546121 2:52769317-52769339 AATTCAGCTGTGAATCCGTCTGG - Intergenic
930863187 2:56096080-56096102 AATTCAGCTGTGAATCCGTCTGG - Intergenic
930945348 2:57067331-57067353 AATTCAGCTGTGAATCCGTCTGG + Intergenic
931170119 2:59794123-59794145 GAAACTACAGTGAGTCCGTCAGG - Intergenic
931551507 2:63451481-63451503 AATTCAGCTGTGAATCCGTCTGG - Intronic
931907270 2:66855863-66855885 AATTCAGCTGTGAATCCGTCTGG + Intergenic
932377247 2:71248038-71248060 AATTCAGCTGTGAATCCGTCTGG + Intergenic
932841232 2:75084531-75084553 AATTCGGCTGTGAGTCCGTCTGG + Intronic
933050528 2:77596219-77596241 AATTCAGCTGTGAATCCGTCTGG - Intergenic
933062661 2:77757153-77757175 AATTCAGCTGTGAATCCGTCTGG - Intergenic
933631619 2:84665637-84665659 AATTCAGCTGTGAATCCGTCTGG - Intronic
934500382 2:94856838-94856860 AAAACAGCTGAGAGTCCGTTTGG + Intergenic
934559228 2:95303692-95303714 GAGGCAGCTGCGAGTCCAGCTGG + Intronic
934675784 2:96248813-96248835 GAGACAGCTGTGAGTCCGTCTGG - Exonic
935193109 2:100794056-100794078 GACACAGCTGTGACTCCTGCCGG - Intergenic
936999635 2:118453903-118453925 AATTCAGCTGTGAATCCGTCTGG + Intergenic
937148175 2:119665537-119665559 AATACAGCTGTGAATCCATCTGG - Intergenic
938167188 2:129040745-129040767 AATTCAGCTGTGAATCCGTCTGG + Intergenic
939110036 2:137995553-137995575 GACTCAGCTGTGAATCCATCTGG - Intronic
939731137 2:145785903-145785925 AATTCAGCTGTGAATCCGTCTGG - Intergenic
940090519 2:149911199-149911221 AATTCAGCTGTGAATCCGTCTGG - Intergenic
940131149 2:150383758-150383780 AATTCAGCTGTGAGTCCATCTGG + Intergenic
940273002 2:151911780-151911802 AATTCAGCTGTGAATCCGTCTGG + Intronic
940890910 2:159034383-159034405 GAAACAGCTGGGAGTTGGTCAGG + Intronic
940946836 2:159627205-159627227 AATTCAGCTGTGAATCCGTCTGG - Intergenic
942272365 2:174289486-174289508 AATTCAGCTGTGAGTCCGTCTGG - Intergenic
942392179 2:175507000-175507022 AATTCAGCTGTGAATCCGTCTGG - Intergenic
942722555 2:178969139-178969161 AATTCAGCTGTGAATCCGTCTGG - Intronic
942873892 2:180768617-180768639 AATTCAGCTGTGAATCCGTCTGG - Intergenic
943130284 2:183845445-183845467 AATTCAGCTGTGAATCCGTCTGG - Intergenic
943282845 2:185959708-185959730 AATTCAGCTGTGAATCCGTCAGG - Intergenic
943351032 2:186796513-186796535 AATTCAGCTGTGAGTCTGTCTGG - Intergenic
943607485 2:189993605-189993627 AATTCAGCTGTGAGTCTGTCTGG + Intronic
944569315 2:201027351-201027373 AATTCAGCTGTGAATCCGTCTGG - Intronic
945486576 2:210403722-210403744 AAGTCGGCTGTGAATCCGTCAGG + Intergenic
945603064 2:211891944-211891966 AAGTCAGCTGTGAATCCATCTGG - Intronic
947132069 2:226938659-226938681 AATTCAGCTGTGAATCCGTCTGG - Intronic
947449284 2:230191670-230191692 GAATCAGCTGTGAATCCATCTGG - Intronic
948185717 2:236019832-236019854 GACACTGCAGTGAGTCCTTCAGG - Intronic
948667411 2:239545369-239545391 GAGGCAGCTGTGGGCCCGCCAGG - Intergenic
1169000725 20:2166082-2166104 GAGACAGCAGTGAGCCCTCCCGG + Intronic
1170081187 20:12478492-12478514 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1170707476 20:18757875-18757897 GATTCAGCTGTGAATCCATCTGG + Intronic
1171434398 20:25108782-25108804 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1172274771 20:33673638-33673660 GAGACAGCTTTGCCTCCCTCTGG + Intronic
1172604089 20:36202932-36202954 CAGACAGCTGTGAGCCCAACTGG + Intronic
1173641264 20:44603754-44603776 GAGACAGCTTTGATTCATTCAGG - Intronic
1175323421 20:58105868-58105890 GAGACAGTAGTGTGTCAGTCAGG - Intergenic
1176144454 20:63559383-63559405 GAGTCAGATGGGAGTCAGTCAGG + Intronic
1176587994 21:8608665-8608687 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1176625592 21:9088497-9088519 AAAACAGCTGAGAGTCCGTTTGG - Intergenic
1177092220 21:16783319-16783341 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1177365295 21:20127548-20127570 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1177960624 21:27661812-27661834 AAGTCGGCTGTGAATCCGTCTGG - Intergenic
1180100246 21:45580578-45580600 GAGGCAGCTGTGTCTCCGTCAGG - Intergenic
1180138573 21:45876990-45877012 CACACAGCTGTGAGTGCGGCTGG - Intronic
1180254474 21:46615119-46615141 AATACAGCTGTGAATCCATCTGG + Intergenic
1180270826 22:10585664-10585686 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1180570287 22:16710118-16710140 AACTCAGCTGTGAGTACGTCTGG - Intergenic
1180572733 22:16743724-16743746 GATTCAGCTGTGAATCCTTCTGG - Intergenic
1182277747 22:29201162-29201184 GTGGCAGCTGTGAGTCCATGTGG - Intergenic
1182481620 22:30612953-30612975 GAGCCAACTGTGAGTTTGTCAGG + Exonic
1182682720 22:32094444-32094466 AATTCAGCTGTGAATCCGTCTGG + Intronic
1184491984 22:44815050-44815072 CTGACATCTGTGAGTCCCTCTGG - Intronic
1185314934 22:50174892-50174914 AGCACAGCTTTGAGTCCGTCAGG + Intronic
949800842 3:7902646-7902668 AATTCAGCTGTGAATCCGTCCGG + Intergenic
950566794 3:13774096-13774118 GAGAGAGCTGTGAGTGCGCAGGG + Intergenic
950850076 3:16053863-16053885 GAGCCAGCTGGGAGTAGGTCTGG + Intergenic
951005919 3:17615488-17615510 AATTCAGCTGTGAATCCGTCTGG + Intronic
951130688 3:19039770-19039792 AATTCAGCTGTGAATCCGTCTGG + Intergenic
951268183 3:20594511-20594533 AATTCAGCTGTGAATCCGTCTGG + Intergenic
951368607 3:21815717-21815739 AATTCAGCTGTGAATCCGTCTGG - Intronic
951795058 3:26529418-26529440 AATTCAGCTGTGAATCCGTCTGG + Intergenic
955030551 3:55212645-55212667 GATTCAGCTGTGAATCCATCTGG - Intergenic
955667477 3:61365824-61365846 AATTCAGCTGTGAATCCGTCTGG - Intergenic
956894291 3:73643957-73643979 GAGACAGCTGTGAGTGGGGATGG - Intergenic
956973676 3:74555517-74555539 AATTCAGCTGTGAATCCGTCTGG + Intergenic
957092730 3:75748226-75748248 AATTCAGCTGTGATTCCGTCTGG - Intronic
957908194 3:86584515-86584537 TATTCAGCTGTGAATCCGTCTGG - Intergenic
958155511 3:89751013-89751035 AATTCAGCTGTGAATCCGTCTGG - Intergenic
958423332 3:93953116-93953138 AATTCAGCTGTGAATCCGTCTGG - Intronic
958545986 3:95550872-95550894 AATTCAGCTGTGAATCCGTCTGG + Intergenic
958848269 3:99291203-99291225 AATTCAGCTGTGAGTCCATCTGG + Intergenic
959074859 3:101739207-101739229 AATTCAGCTGTGAATCCGTCTGG - Intronic
959495005 3:107039975-107039997 AATTCAGCTGTGAATCCGTCTGG - Intergenic
959725937 3:109541714-109541736 AATTCAGCTGTGAATCCGTCTGG - Intergenic
959778918 3:110204720-110204742 AATTCAGCTGTGAATCCGTCTGG - Intergenic
959922054 3:111879156-111879178 CATTCAGCTGTGAATCCGTCTGG + Intronic
960377773 3:116924605-116924627 AATTCAGCTGTGAATCCGTCTGG + Intronic
960476814 3:118140515-118140537 AATTCAGCTGTGAATCCGTCTGG + Intergenic
960496404 3:118380781-118380803 GTGACAGCTGTGAGTCAGACAGG + Intergenic
960828209 3:121814797-121814819 AATTCAGCTGTGAATCCGTCTGG - Intronic
960832059 3:121860274-121860296 AATTCAGCTGTGAATCCGTCTGG + Intronic
960835743 3:121904953-121904975 AATTCAGCTGTGAATCCGTCTGG + Intronic
961487305 3:127226038-127226060 GTGACAGCTGTGAGCCAGGCTGG + Intergenic
961981426 3:131083380-131083402 GAGACAGCTGTGGGGCCGCCTGG + Intronic
962192159 3:133322558-133322580 AATTCAGCTGTGAATCCGTCTGG - Intronic
962287356 3:134098318-134098340 AATTCAGCTGTGAATCCGTCTGG + Intronic
962907682 3:139819954-139819976 AATTCAGCTGTGAATCCGTCTGG - Intergenic
963551441 3:146729013-146729035 AATTCAGCTGTGAATCCGTCTGG - Intergenic
964183665 3:153916749-153916771 AATTCAGCTGTGAATCCGTCTGG - Intergenic
964575393 3:158161192-158161214 GAGACATCTGTGAGTCAGCTGGG + Intronic
964772911 3:160243405-160243427 GATTCAGCTGTGAATCTGTCTGG - Intronic
964900678 3:161655159-161655181 AATTCAGCTGTGAATCCGTCTGG + Intergenic
965511268 3:169570376-169570398 AATTCAGCTGTGAATCCGTCTGG - Intronic
966000239 3:174940617-174940639 AATTCAGCTGTGAGTCCATCAGG + Intronic
968692460 4:2000684-2000706 AATTCAGCTGTGAGTCCGTCTGG - Intronic
968874970 4:3261895-3261917 AAGACAGCAGGGAGTCCCTCTGG - Intronic
969545058 4:7820617-7820639 GAGACAGCCGTGACTCCCTAAGG + Intronic
970494629 4:16612739-16612761 AATTCAGCTGTGAATCCGTCCGG - Intronic
970666180 4:18339847-18339869 AATTCAGCTGTGAATCCGTCTGG + Intergenic
970791710 4:19865395-19865417 AACTCAGCTATGAGTCCGTCTGG + Intergenic
971943031 4:33239995-33240017 GAGATTGCTGTTAGTCCGACGGG + Intergenic
972043568 4:34636351-34636373 AATTCAGCTGTGAATCCGTCTGG + Intergenic
972232442 4:37090571-37090593 AATTCAGCTGTGAATCCGTCTGG + Intergenic
972373153 4:38445395-38445417 AATTCAGCTGTGAATCCGTCTGG + Intergenic
972417010 4:38850767-38850789 AATTCAGCTGTGAATCCGTCTGG - Intronic
973091545 4:46143397-46143419 AATTCAGCTGTGAGTCCATCTGG + Intergenic
973556503 4:52088886-52088908 AATTCAGCTGTGAATCCGTCTGG + Intronic
974158108 4:58101132-58101154 TATTCAGCTGTGAATCCGTCTGG + Intergenic
974306783 4:60153014-60153036 AATTCAGCTGTGAGTCCATCTGG + Intergenic
974619371 4:64336116-64336138 AATTCAGCTGTGAATCCGTCTGG + Intronic
975178242 4:71312309-71312331 AATTCAGCTGTGAATCCGTCAGG - Intronic
975292633 4:72695123-72695145 AATTCAGCTGTGAATCCGTCTGG - Intergenic
975943983 4:79682393-79682415 GAGTCAGCTGTGATTCCAACTGG + Intergenic
976957175 4:90915052-90915074 AATTCAGCTGTGAATCCGTCTGG - Intronic
977047219 4:92082507-92082529 AATTCAGCTGTGAATCCGTCTGG - Intergenic
977218523 4:94311742-94311764 AATTCAGCTGTGAGTCCATCTGG + Intronic
977635801 4:99296801-99296823 AATTCAGCTGTGAATCCGTCTGG - Intergenic
978695171 4:111568655-111568677 AATTCAGCTGTGAATCCGTCTGG - Intergenic
978743129 4:112161696-112161718 AATTCAGCTGTGAATCCGTCTGG - Intronic
978845523 4:113268852-113268874 AATTCAGCTGTGAATCCGTCTGG + Intronic
978925850 4:114242724-114242746 AATTCAGCTGTGAGTCCATCTGG + Intergenic
979044000 4:115837777-115837799 AATTCAGCTGTGAATCCGTCTGG - Intergenic
979062524 4:116081120-116081142 AATTCAGCTGTGAATCCGTCTGG + Intergenic
979115595 4:116818584-116818606 AATTCAGCTGTGAGTCCATCTGG - Intergenic
979398673 4:120220597-120220619 AATTCAGCTGTGAATCCGTCTGG + Intergenic
979512553 4:121570840-121570862 AATTCAGCTGTGAATCCGTCTGG - Intergenic
979554653 4:122031260-122031282 AATTCAGCTGTGAATCCGTCTGG + Intergenic
980662011 4:135873028-135873050 AATTCAGCTGTGAATCCGTCTGG + Intergenic
980761135 4:137235637-137235659 AATTCAGCTGTGAATCCGTCTGG + Intergenic
980861565 4:138505077-138505099 AATTCAGCTGTGAATCCGTCTGG + Intergenic
981053676 4:140337835-140337857 AATTCAGCTGTGAATCCGTCTGG - Intronic
981514622 4:145593922-145593944 AATTCAGCTGTGAATCCGTCTGG + Intergenic
981790659 4:148533068-148533090 AATTCAGCTGTGAGTCCATCTGG + Intergenic
982809492 4:159807760-159807782 AATTCAGCTGTGAGTCCATCTGG - Intergenic
982880394 4:160706584-160706606 AATTCAGCTGTGAATCCGTCTGG + Intergenic
982908897 4:161114853-161114875 AATTCAGCTGTGAATCCGTCTGG + Intergenic
983072472 4:163285160-163285182 AATTCAGCTGTGAATCCGTCTGG + Intergenic
983757305 4:171355868-171355890 AATTCAGCTGTGAATCCGTCTGG + Intergenic
983858282 4:172672618-172672640 CATTCAGCTGTGAATCCGTCTGG + Intronic
984384116 4:179033453-179033475 AAATCAGCTGTGAATCCGTCTGG - Intergenic
984457299 4:179986461-179986483 AATTCAGCTGTGAATCCGTCTGG + Intergenic
984592268 4:181629941-181629963 AATTCGGCTGTGAGTCCGTCTGG + Intergenic
984857972 4:184211625-184211647 AATTCAGCTGTGAATCCGTCTGG - Intronic
985831316 5:2234210-2234232 AATTCAGCTGTGAGTCCCTCAGG + Intergenic
987157117 5:15100178-15100200 AATTCAGCTGTGAATCCGTCTGG - Intergenic
987275608 5:16359126-16359148 AATTCAGCTGTGAATCCGTCTGG + Intergenic
987991151 5:25214503-25214525 AATTCAGCTGTGAGTCCATCTGG - Intergenic
988195924 5:28005480-28005502 AATTCAGCTGTGAGTCCTTCTGG - Intergenic
988846759 5:35135420-35135442 GAGGCAGCTGTGTCTCCCTCTGG - Intronic
989473417 5:41847317-41847339 GATTCAGCTGTGAATCCATCTGG - Intronic
990038568 5:51352195-51352217 AATTCAGCTGTGAATCCGTCTGG - Intergenic
990069221 5:51758099-51758121 AATTCAGCTGTGAATCCGTCTGG + Intergenic
990721055 5:58696525-58696547 AATTCAGCTGTGAATCCGTCTGG + Intronic
991046447 5:62227935-62227957 AATTCAGCTGTGAATCCGTCTGG + Intergenic
992183157 5:74217981-74218003 AATTCAGCTGTGAATCCGTCTGG - Intergenic
992383509 5:76262048-76262070 AATTCAGCTGTGAATCCGTCTGG + Intronic
994277062 5:97851868-97851890 GATTCAGCTGTGAATCCTTCTGG - Intergenic
995633498 5:114159607-114159629 AATTCAGCTGTGAGTCCATCTGG + Intergenic
995811370 5:116110469-116110491 AATTCAGCTGTGAATCCGTCTGG + Intronic
996320281 5:122207937-122207959 AATTCAGCTGTGAATCCGTCTGG - Intergenic
996854630 5:127991379-127991401 AATTCAGCTGTGAATCCGTCTGG + Intergenic
996894159 5:128459338-128459360 AATTCAGCTGTGAATCCGTCTGG - Intronic
996917464 5:128729478-128729500 AAGTCGGCTGTGACTCCGTCTGG - Intronic
997201493 5:132012381-132012403 GAGACACCTGTGATTCCATGTGG - Intergenic
997657608 5:135566975-135566997 GAGTCTGCCGTGAGTCCGTCTGG + Intergenic
999593907 5:153181251-153181273 AAGTCAGCTGTGAATCCATCTGG - Intergenic
999659895 5:153849981-153850003 AATATAGCTGTGAATCCGTCTGG + Intergenic
1000158788 5:158578834-158578856 AATTCAGCTGTGAGTCCGTCTGG + Intergenic
1000212774 5:159122989-159123011 GAGGCTGCAGTGAGTCTGTCTGG + Intergenic
1000557332 5:162742127-162742149 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1000746724 5:165043060-165043082 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1001983662 5:176055268-176055290 AATTCAGCTGTGAATCCGTCTGG - Intronic
1002615133 5:180448280-180448302 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1003634948 6:7823684-7823706 GAGAAAGCTGTGTGGCTGTCTGG + Intronic
1003686712 6:8311594-8311616 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1003820028 6:9885836-9885858 AATTCAGCTGTGAATCCGTCTGG - Intronic
1005506802 6:26476330-26476352 GATACTGGTGTGAGTCTGTCAGG - Intronic
1008431463 6:51422519-51422541 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1008633540 6:53386572-53386594 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1010878752 6:81141661-81141683 AATTCAGCTGTGAGTCCATCTGG - Intergenic
1011209486 6:84939527-84939549 AATTCGGCTGTGAGTCCGTCTGG - Intergenic
1011619849 6:89232628-89232650 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1011716747 6:90114055-90114077 GATTCAGCTGTGAATCCATCAGG - Intronic
1011777967 6:90753175-90753197 GAGACAGCTGAGAGATTGTCTGG - Intergenic
1011983011 6:93408548-93408570 GAGACAGGTTTGACTCCTTCAGG + Intronic
1012043607 6:94240861-94240883 AAGTCAGCTCTGAATCCGTCTGG - Intergenic
1012155749 6:95818027-95818049 GAATCAGCTGTGAATCTGTCTGG - Intergenic
1012298964 6:97560581-97560603 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1012349888 6:98236866-98236888 CAGACAGTTTTGAGTCCTTCAGG + Intergenic
1012933543 6:105341921-105341943 AATTCAGCTGTGAGTCCATCTGG - Intronic
1012941306 6:105418546-105418568 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1013025359 6:106266382-106266404 AATTCAGCTGTGAATCCGTCTGG - Intronic
1013276031 6:108585624-108585646 GAGACAGCTGGGAGTCTGCAAGG + Intronic
1013856982 6:114584739-114584761 GATTCAGCTGTGAATCCATCTGG - Intergenic
1013930043 6:115519631-115519653 AAGTCAGCTGTGAATCTGTCTGG - Intergenic
1013973102 6:116044122-116044144 AATTCAGCTGTGAATCCGTCTGG - Intronic
1014063296 6:117097871-117097893 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1014519959 6:122430111-122430133 AATTCAGCTGTGAATCCGTCTGG + Intronic
1014890591 6:126839403-126839425 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1017226846 6:152031677-152031699 AATTCAGCTGTGAATCCGTCTGG - Intronic
1020533746 7:9367644-9367666 GACTCAGCTGTGAATCCATCTGG - Intergenic
1021064943 7:16161789-16161811 AAATCAGCTGTGACTCCGTCTGG + Intronic
1021466267 7:20947218-20947240 AATGCAGCTGTGAGTCCATCTGG - Intergenic
1022079435 7:27005046-27005068 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1022986732 7:35662478-35662500 AATTCAGCTGTGAATCCGTCTGG + Intronic
1023409759 7:39878037-39878059 GATTCAGCTGTGAATCCATCTGG + Intergenic
1023498311 7:40821368-40821390 AATTCAGCTGTGAATCCGTCTGG + Intronic
1023650895 7:42368039-42368061 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1024016306 7:45318804-45318826 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1024738414 7:52330274-52330296 AATTCAGCTGTGAGTCCATCTGG - Intergenic
1024946826 7:54816604-54816626 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1025043110 7:55665519-55665541 GATTCAGCTGTGAATCCATCTGG - Intergenic
1025136030 7:56414051-56414073 GATTCAGCTGTGAATCCATCTGG - Intergenic
1026429584 7:70331152-70331174 AATTCAGCTGTGAATCCGTCTGG + Intronic
1027732976 7:81899433-81899455 AATTCAGCTGTGAGTCCATCTGG + Intergenic
1028100057 7:86808350-86808372 AATTCAGCTGTGAATCCGTCTGG + Intronic
1028218022 7:88159293-88159315 AATTCAGCTGTGAGTCTGTCTGG - Intronic
1028316466 7:89408523-89408545 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1028332347 7:89610375-89610397 GATTCAGCTGTGAACCCGTCTGG + Intergenic
1028347811 7:89804827-89804849 AATTCAGCTGTGAGTCCATCTGG + Intergenic
1028644476 7:93079925-93079947 AATTCAGCTGTGAGTCTGTCTGG - Intergenic
1028821580 7:95217574-95217596 AATTCAGCTGTGAATCCGTCTGG + Intronic
1030147986 7:106375700-106375722 GAGAGAGCTGTGTGTCCAACTGG + Intergenic
1030890426 7:114992955-114992977 GGTAGAGCTGTGAATCCGTCTGG + Intronic
1032559721 7:132875995-132876017 GAGACAGCTGTGCGTCTGTAAGG - Intronic
1032764651 7:134979529-134979551 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1032942872 7:136815284-136815306 AATTCGGCTGTGAGTCCGTCTGG + Intergenic
1032965870 7:137096778-137096800 TATACAGCTGTGAATCCATCTGG - Intergenic
1033544759 7:142389738-142389760 CAGACAGCTGTGAGTACCTGGGG + Intergenic
1033990365 7:147276287-147276309 AATTCAGCTGTGAGTCCATCTGG + Intronic
1034714779 7:153231607-153231629 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1035599166 8:886004-886026 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1037557342 8:20037923-20037945 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1037656853 8:20891430-20891452 GAGGCAGCTGTGAGATCTTCTGG - Intergenic
1037664861 8:20959748-20959770 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1037816964 8:22117482-22117504 GAGAGAGCTGTGTGTCCCTGGGG + Intronic
1037988445 8:23304073-23304095 AAGACAGCTGGGAGGCCCTCTGG + Intronic
1038377811 8:27060448-27060470 AATTCAGCTGTGAATCCGTCCGG + Intergenic
1039685603 8:39798643-39798665 AATTCAGCTGTGAGTCTGTCTGG + Intronic
1041221849 8:55659681-55659703 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1041275056 8:56148747-56148769 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1041583636 8:59491738-59491760 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1041634455 8:60127263-60127285 AATTCAGCTGTGAGTCTGTCTGG + Intergenic
1041772169 8:61483479-61483501 AATTCAGCTGTGAATCCGTCTGG - Intronic
1042853202 8:73237456-73237478 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1042897113 8:73682999-73683021 AATTCAGCTGTGAATCCGTCTGG - Intronic
1043339723 8:79222930-79222952 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1043362897 8:79496339-79496361 AAATCAGCTGTGAATCCGTCAGG + Intergenic
1043381911 8:79711576-79711598 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1043411966 8:80006808-80006830 AATTCAGCTGTGAATCCGTCTGG - Intronic
1043535709 8:81202019-81202041 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1043642122 8:82467479-82467501 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1043757125 8:84017476-84017498 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1043929815 8:86077850-86077872 AATTCAGCTGTGAGTCCATCTGG - Intronic
1044440525 8:92218670-92218692 AATTCGGCTGTGAGTCCGTCTGG + Intergenic
1045671298 8:104556652-104556674 AATTCAGCTGTGAATCCGTCTGG - Intronic
1045829581 8:106442519-106442541 AATTCAGCTGTGAATCCGTCTGG + Intronic
1045867353 8:106883263-106883285 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1046129721 8:109952428-109952450 AATTCAGCTGTGAGTCCATCTGG + Intergenic
1046394866 8:113628658-113628680 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1048149498 8:131880303-131880325 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1050368701 9:4898680-4898702 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1050390893 9:5143296-5143318 AATTCAGCTGTGAATCCGTCTGG + Intronic
1050632657 9:7577021-7577043 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1051248985 9:15140102-15140124 GATACAGCTGTGTATCCATCTGG + Intergenic
1051451362 9:17201438-17201460 AATTCAGCTGTGAATCCGTCTGG + Intronic
1051970847 9:22885679-22885701 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1052052388 9:23863207-23863229 AATTCAGCTGTGAGTCCGTCTGG + Intergenic
1052551036 9:29949456-29949478 GATTCAGCTGTGAATCCATCTGG + Intergenic
1052852392 9:33386002-33386024 GAGCCAGCAGGGAGTCCCTCCGG - Intronic
1053656781 9:40223706-40223728 AAAACAGCTGAGAGTCCGTTTGG - Intronic
1053680491 9:40482553-40482575 GAGCCAGCAGGGAGTCCCTCCGG - Intergenic
1053751437 9:41260594-41260616 GATTCAGCTGTGAATCCATCTGG + Intergenic
1053930480 9:43110864-43110886 GAGCCAGCAGGGAGTCCCTCCGG - Intergenic
1054256959 9:62824923-62824945 GATTCAGCTGTGAATCCATCTGG + Intergenic
1054283221 9:63142382-63142404 GAGCCAGCAGGGAGTCCCTCCGG + Intergenic
1054293576 9:63318068-63318090 GAGCCAGCAGGGAGTCCCTCCGG - Intergenic
1054334335 9:63790581-63790603 GATTCAGCTGTGAATCCATCTGG - Intergenic
1054357230 9:64072217-64072239 AAAACAGCTGAGAGTCCGTTTGG - Intergenic
1054368900 9:64369984-64370006 AAAACAGCTGAGAGTCCGTTTGG - Intronic
1054391598 9:64622557-64622579 GAGCCAGCAGGGAGTCCCTCCGG - Intergenic
1054504130 9:65893771-65893793 GAGCCAGCAGGGAGTCCCTCCGG + Intronic
1054676532 9:67859736-67859758 AAAACAGCTGAGAGTCCGTTTGG - Intronic
1054864040 9:69981688-69981710 GATACAACTGAGACTCCGTCCGG - Intergenic
1055181883 9:73398351-73398373 CATTCAGCTGTGAATCCGTCTGG + Intergenic
1055276245 9:74620146-74620168 AATTCAGCTGTGAATCCGTCTGG + Intronic
1058012324 9:99992054-99992076 AAGTCGGCTGTGAATCCGTCTGG - Intronic
1059594714 9:115707179-115707201 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1062328455 9:136024010-136024032 GTGCCAGCTGTGAGTTCCTCTGG + Intronic
1202802612 9_KI270720v1_random:14202-14224 AATTCAGCTGTGAGTCCATCTGG + Intergenic
1203748761 Un_GL000218v1:58958-58980 AAAACAGCTGAGAGTCCGTTTGG - Intergenic
1203378623 Un_KI270435v1:5793-5815 GATTCAGCTGTGAATCCTTCTGG + Intergenic
1203617999 Un_KI270749v1:87253-87275 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1185471005 X:383110-383132 GAGGCAGCTTGGAGACCGTCTGG - Intronic
1186964119 X:14769266-14769288 AATTCAGCTGTGAATCCGTCGGG + Intergenic
1187628135 X:21139873-21139895 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1187705093 X:22002042-22002064 AATTCAGCTGTGAGTCCGTCTGG + Intergenic
1187839619 X:23473591-23473613 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1188389086 X:29597640-29597662 AATTCAGCTGTGAGTCCATCTGG + Intronic
1188628081 X:32312973-32312995 AATTCAGCTGTGAATCCGTCTGG - Intronic
1188771478 X:34159113-34159135 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1188977915 X:36697757-36697779 ACTTCAGCTGTGAGTCCGTCCGG - Intergenic
1189243720 X:39545959-39545981 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1189678600 X:43490216-43490238 AATTCAGCTGTGAGTCTGTCTGG - Intergenic
1190606409 X:52147933-52147955 AATTCGGCTGTGAGTCCGTCTGG + Intergenic
1190607852 X:52163440-52163462 AATTCGGCTGTGAGTCCGTCTGG - Intergenic
1191043063 X:56106080-56106102 GAGACAGCTGTTAGTCTGATGGG + Intergenic
1191097157 X:56685610-56685632 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1191188213 X:57636208-57636230 AATACAGCTGTGAATCCATCTGG - Intergenic
1191198212 X:57747656-57747678 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1191743387 X:64460184-64460206 AATTCAGCTGTGAGTCTGTCTGG + Intergenic
1191746102 X:64489047-64489069 GACTCAGCTGTAAATCCGTCTGG + Intergenic
1192044903 X:67661795-67661817 GATTCAGCTGTGAATCCATCTGG + Intronic
1192398794 X:70812984-70813006 AATTCAGCTGTGACTCCGTCTGG - Intronic
1192404083 X:70866433-70866455 GATTCAGCTGTGAATCTGTCTGG - Intronic
1192524872 X:71833484-71833506 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1192843918 X:74885685-74885707 AATTCAGCTGTGAATCCGTCTGG - Intronic
1193104692 X:77657148-77657170 GAGAGAGCTGTGAGGGCGTATGG + Intronic
1193251386 X:79295223-79295245 GATTCAGCTGTGAATCCATCTGG - Intergenic
1193361388 X:80583472-80583494 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1193402993 X:81068045-81068067 AATTCAGCTGTGAGTCTGTCTGG - Intergenic
1193775705 X:85638837-85638859 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1193835336 X:86336352-86336374 AATTCAGCTGTGAGTCTGTCTGG + Intronic
1193835568 X:86339103-86339125 AATTCAGCTGTGAATCCGTCTGG - Intronic
1193907085 X:87257123-87257145 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1193922418 X:87445721-87445743 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1194021688 X:88699178-88699200 GATTCAGCTGTGAATCTGTCTGG + Intergenic
1194126488 X:90024290-90024312 GATTCAGCTGTGAATCCATCTGG - Intergenic
1194254556 X:91620477-91620499 AATTCAGCTGTGAGTCCATCTGG + Intergenic
1194342210 X:92719050-92719072 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1194601613 X:95928113-95928135 AATTCAGCTGTGAGTCTGTCTGG - Intergenic
1194602384 X:95938335-95938357 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1195019159 X:100809303-100809325 AAGTCTGCTGTGAATCCGTCTGG + Intergenic
1195104410 X:101589912-101589934 AATTCAGCTGTGAGTCTGTCTGG + Intergenic
1195391112 X:104363244-104363266 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1195855908 X:109332422-109332444 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1195987135 X:110642622-110642644 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1197180576 X:123531611-123531633 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1197417025 X:126187827-126187849 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1197589179 X:128387329-128387351 AATTCTGCTGTGAGTCCGTCTGG - Intergenic
1198072468 X:133162893-133162915 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1198237958 X:134754032-134754054 GAGACAGCTGTGTGTTTGTGGGG - Intronic
1198660062 X:138958625-138958647 AATTCAGCTGTGAATCCGTCTGG + Intronic
1198858819 X:141047631-141047653 AATTCAGCTGTGAGTCTGTCTGG - Intergenic
1198903877 X:141539758-141539780 AATTCAGCTGTGAGTCTGTCTGG + Intergenic
1198958177 X:142155331-142155353 AATTCAGCTGTGAGTCCATCTGG + Intergenic
1199077557 X:143541754-143541776 GAATCAGCTGTGAATCCATCTGG - Intergenic
1199275940 X:145941963-145941985 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1199287205 X:146066845-146066867 GAGTCAGCTGTGACTCAGTGGGG + Intergenic
1200378773 X:155812331-155812353 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1200573341 Y:4860070-4860092 AATTCAGCTGTGAGTCCATCTGG + Intergenic
1200650567 Y:5835745-5835767 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1201162117 Y:11173927-11173949 AAAACAGCTGAGAGTCCGTTTGG - Intergenic
1201740145 Y:17315162-17315184 AATTCAGCTGTGAATCCGTCGGG - Intergenic
1201740747 Y:17322367-17322389 AATTCAGCTGTGAATCCGTCGGG + Intergenic
1201775893 Y:17665292-17665314 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1201825663 Y:18240700-18240722 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1202341859 Y:23877920-23877942 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1202528908 Y:25792166-25792188 AATTCAGCTGTGAATCCGTCTGG - Intergenic