ID: 934677929

View in Genome Browser
Species Human (GRCh38)
Location 2:96262964-96262986
Sequence TCGGGCCAGGCCAGGCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2514
Summary {0: 1, 1: 4, 2: 53, 3: 355, 4: 2101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934677929_934677933 -6 Left 934677929 2:96262964-96262986 CCTCCATGCCTGGCCTGGCCCGA 0: 1
1: 4
2: 53
3: 355
4: 2101
Right 934677933 2:96262981-96263003 GCCCGAATAATTTCTTAGAAAGG 0: 1
1: 0
2: 0
3: 3
4: 73
934677929_934677935 -5 Left 934677929 2:96262964-96262986 CCTCCATGCCTGGCCTGGCCCGA 0: 1
1: 4
2: 53
3: 355
4: 2101
Right 934677935 2:96262982-96263004 CCCGAATAATTTCTTAGAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934677929 Original CRISPR TCGGGCCAGGCCAGGCATGG AGG (reversed) Intronic