ID: 934677929 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:96262964-96262986 |
| Sequence | TCGGGCCAGGCCAGGCATGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2514 | |||
| Summary | {0: 1, 1: 4, 2: 53, 3: 355, 4: 2101} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 934677929_934677933 | -6 | Left | 934677929 | 2:96262964-96262986 | CCTCCATGCCTGGCCTGGCCCGA | 0: 1 1: 4 2: 53 3: 355 4: 2101 |
||
| Right | 934677933 | 2:96262981-96263003 | GCCCGAATAATTTCTTAGAAAGG | 0: 1 1: 0 2: 0 3: 3 4: 73 |
||||
| 934677929_934677935 | -5 | Left | 934677929 | 2:96262964-96262986 | CCTCCATGCCTGGCCTGGCCCGA | 0: 1 1: 4 2: 53 3: 355 4: 2101 |
||
| Right | 934677935 | 2:96262982-96263004 | CCCGAATAATTTCTTAGAAAGGG | 0: 1 1: 0 2: 0 3: 7 4: 149 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 934677929 | Original CRISPR | TCGGGCCAGGCCAGGCATGG AGG (reversed) | Intronic | ||