ID: 934678469

View in Genome Browser
Species Human (GRCh38)
Location 2:96266068-96266090
Sequence CGCGCCGCCGGCTCTGCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934678457_934678469 7 Left 934678457 2:96266038-96266060 CCCCGTCCCCCGCGCGCGTCACA 0: 1
1: 0
2: 0
3: 5
4: 68
Right 934678469 2:96266068-96266090 CGCGCCGCCGGCTCTGCGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 96
934678450_934678469 27 Left 934678450 2:96266018-96266040 CCGCCTCCTCCGGCTCCCCGCCC 0: 1
1: 2
2: 18
3: 256
4: 2455
Right 934678469 2:96266068-96266090 CGCGCCGCCGGCTCTGCGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 96
934678456_934678469 10 Left 934678456 2:96266035-96266057 CCGCCCCGTCCCCCGCGCGCGTC 0: 1
1: 0
2: 2
3: 40
4: 409
Right 934678469 2:96266068-96266090 CGCGCCGCCGGCTCTGCGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 96
934678449_934678469 30 Left 934678449 2:96266015-96266037 CCTCCGCCTCCTCCGGCTCCCCG 0: 1
1: 1
2: 12
3: 159
4: 1751
Right 934678469 2:96266068-96266090 CGCGCCGCCGGCTCTGCGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 96
934678460_934678469 1 Left 934678460 2:96266044-96266066 CCCCCGCGCGCGTCACAGCCTGG 0: 1
1: 0
2: 1
3: 7
4: 113
Right 934678469 2:96266068-96266090 CGCGCCGCCGGCTCTGCGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 96
934678465_934678469 -2 Left 934678465 2:96266047-96266069 CCGCGCGCGTCACAGCCTGGGCG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 934678469 2:96266068-96266090 CGCGCCGCCGGCTCTGCGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 96
934678454_934678469 12 Left 934678454 2:96266033-96266055 CCCCGCCCCGTCCCCCGCGCGCG 0: 1
1: 1
2: 14
3: 131
4: 1052
Right 934678469 2:96266068-96266090 CGCGCCGCCGGCTCTGCGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 96
934678459_934678469 5 Left 934678459 2:96266040-96266062 CCGTCCCCCGCGCGCGTCACAGC 0: 1
1: 0
2: 0
3: 6
4: 88
Right 934678469 2:96266068-96266090 CGCGCCGCCGGCTCTGCGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 96
934678458_934678469 6 Left 934678458 2:96266039-96266061 CCCGTCCCCCGCGCGCGTCACAG 0: 1
1: 0
2: 1
3: 5
4: 92
Right 934678469 2:96266068-96266090 CGCGCCGCCGGCTCTGCGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 96
934678462_934678469 0 Left 934678462 2:96266045-96266067 CCCCGCGCGCGTCACAGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 934678469 2:96266068-96266090 CGCGCCGCCGGCTCTGCGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 96
934678453_934678469 18 Left 934678453 2:96266027-96266049 CCGGCTCCCCGCCCCGTCCCCCG 0: 1
1: 0
2: 18
3: 202
4: 1711
Right 934678469 2:96266068-96266090 CGCGCCGCCGGCTCTGCGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 96
934678451_934678469 24 Left 934678451 2:96266021-96266043 CCTCCTCCGGCTCCCCGCCCCGT 0: 1
1: 0
2: 5
3: 69
4: 865
Right 934678469 2:96266068-96266090 CGCGCCGCCGGCTCTGCGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 96
934678455_934678469 11 Left 934678455 2:96266034-96266056 CCCGCCCCGTCCCCCGCGCGCGT 0: 1
1: 0
2: 4
3: 48
4: 386
Right 934678469 2:96266068-96266090 CGCGCCGCCGGCTCTGCGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 96
934678452_934678469 21 Left 934678452 2:96266024-96266046 CCTCCGGCTCCCCGCCCCGTCCC 0: 1
1: 0
2: 22
3: 183
4: 1552
Right 934678469 2:96266068-96266090 CGCGCCGCCGGCTCTGCGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 96
934678464_934678469 -1 Left 934678464 2:96266046-96266068 CCCGCGCGCGTCACAGCCTGGGC 0: 1
1: 0
2: 0
3: 5
4: 160
Right 934678469 2:96266068-96266090 CGCGCCGCCGGCTCTGCGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934678469 Original CRISPR CGCGCCGCCGGCTCTGCGCA GGG Intergenic
900305285 1:2003788-2003810 CACGCCGCCGGCGCCGCGGAGGG - Exonic
901459529 1:9383296-9383318 CGCGCCATCTGCTCTGCACAAGG - Intergenic
905862667 1:41361591-41361613 CCGGGCGCCGGCCCTGCGCACGG - Intergenic
913069587 1:115286634-115286656 GGCGCTGCGGGCTCTGCGAAGGG + Exonic
916666979 1:166975541-166975563 CGCGCGGCGGGCTCTGCGGCGGG - Intergenic
918064224 1:181088873-181088895 GGCGCCGACGGCCCTGTGCAGGG + Exonic
921060211 1:211578850-211578872 CTCGGCGCCGGCTCTGAGGACGG - Intergenic
922505128 1:226121852-226121874 CGCGCCCCCAGCGCTGAGCAGGG + Intergenic
922730777 1:227947914-227947936 CGCGCTCCCAGCTCCGCGCAGGG + Intergenic
1065712555 10:28532479-28532501 CGCGCCACCGGCCCTCCGCGGGG - Intronic
1069651494 10:70053060-70053082 CGCGCCGCCGGGGCAGTGCAGGG + Intronic
1073249711 10:102114293-102114315 CGCCCCGGCGGCTCTGGGCTGGG + Intronic
1078057579 11:8019783-8019805 CGCCCCGCCGGCCCTCCGCAGGG + Intronic
1084271318 11:68030809-68030831 GGCGCCGCCAGCTCTGCGCCTGG + Intronic
1090285579 11:125496252-125496274 GGCGCCGCCGGAGCTGCGCGGGG - Exonic
1091243219 11:134069103-134069125 CGCGACTCCGGCTCTGCGCTCGG + Exonic
1091304070 11:134525660-134525682 AGCACCGCCGGCTCTGAGCAGGG + Intergenic
1102101326 12:110281152-110281174 CGCGCCGCCCGCGCCGCGCTGGG + Intronic
1102924921 12:116819365-116819387 CGCGCCGCCGGCTCCGGGTCTGG - Intronic
1103433128 12:120904451-120904473 GGAGCCGACGTCTCTGCGCATGG - Intergenic
1107604030 13:42040813-42040835 CCCGCCGCCGCCGCTGCGCCGGG - Intronic
1107841269 13:44459781-44459803 CTAGGCGCCGGCTCTGTGCAAGG - Intronic
1113594218 13:111519977-111519999 CACGCCGCCAGCTCTGAGCTGGG - Intergenic
1113761563 13:112851311-112851333 CGCCCCGTCGGCTGTGCGGATGG - Intronic
1117722177 14:58638417-58638439 CGCACCCCCGGCGCCGCGCAGGG - Exonic
1122540593 14:102495834-102495856 CCCGCCGGCTGCTCTGGGCAGGG - Intronic
1128944330 15:71810966-71810988 AGCCCCGCCGGCTGTGGGCAAGG + Intronic
1131830818 15:96353695-96353717 CGCGCCGCCTGGCCTGCGCCTGG - Intergenic
1132055626 15:98648832-98648854 GCCGCCGCCTGCTCTGCGCGGGG - Intergenic
1132545305 16:530322-530344 CTGACCGCCTGCTCTGCGCACGG - Intronic
1136579465 16:31142907-31142929 CGCGCCACCCGCTCCGCGCGCGG + Exonic
1138381894 16:56608414-56608436 GGCGCACCCGGCTCTGCACACGG - Exonic
1139526300 16:67518791-67518813 AGCGCCACCTGCTCTGCTCAGGG - Intronic
1139954257 16:70685810-70685832 CGCGGCGGCGGCTAGGCGCACGG + Exonic
1141356337 16:83350106-83350128 CTTGCCGCCAGCTGTGCGCAAGG + Intronic
1142124693 16:88404358-88404380 CGCACCGCCGGCGCCGCCCAGGG - Intergenic
1142672222 17:1492492-1492514 CAGGCCGCTGGCTCTCCGCAGGG - Exonic
1143497715 17:7321911-7321933 CGTGCCGCTGGCTATGCTCATGG - Exonic
1145012700 17:19378717-19378739 CGGGCCCCCGGCTCTGGGCCCGG + Intronic
1146058665 17:29593445-29593467 CGCGCCGCCCGCACCGCGCCGGG + Intronic
1147758275 17:42782153-42782175 CGCGCCCCAGGCTCTGGGCCAGG + Intronic
1160847854 19:1174189-1174211 GGCGCCGCGGGCTCCGCGCCCGG - Exonic
1161282519 19:3453674-3453696 GCCGCCCCCGGCTCTGTGCACGG - Intronic
1161849418 19:6730952-6730974 AGAGCCGCCGGCCCTGCCCATGG + Intronic
1161959616 19:7516369-7516391 CGCGCCGCCGGCCCTGGCCCAGG + Intronic
1162782174 19:13012098-13012120 CGCGCGCCAGGCTTTGCGCACGG - Intronic
1164834797 19:31349980-31350002 CGCGCCCCCGCGTGTGCGCACGG - Intergenic
1165639391 19:37371199-37371221 GGCGCCGCGGGCTCTGCAAACGG - Exonic
1168678345 19:58295293-58295315 CACGCCGCCGGCTTCGCCCATGG - Exonic
925612910 2:5718183-5718205 TGCCCCAGCGGCTCTGCGCATGG - Intergenic
929787732 2:45004323-45004345 GGCGGCTCCGGCTCCGCGCATGG - Intergenic
934678469 2:96266068-96266090 CGCGCCGCCGGCTCTGCGCAGGG + Intergenic
935196611 2:100820124-100820146 CTCCCCGCCGGCTCTGCGTGCGG + Intergenic
937261061 2:120587112-120587134 CGCGCCGCCCGCACTGCCAAGGG + Intergenic
948466865 2:238156482-238156504 CCCCACGCCGGCTCTGCCCATGG + Intergenic
948809228 2:240466398-240466420 AGGGCCGGCGGCTCTGAGCAGGG + Exonic
1174231211 20:49046751-49046773 TGCGCCGCCGCCTCTCCGCTCGG + Intronic
1174611484 20:51801679-51801701 CGGGCCACCCGCGCTGCGCAGGG - Intronic
1175258172 20:57659238-57659260 CGGGTCGCAGGCTCTGTGCAGGG - Intronic
1175961086 20:62636673-62636695 CGCGCCGCCGACTCAGCCCTGGG + Intergenic
1176146909 20:63569570-63569592 CGCCAGGCCGGCTCTACGCACGG - Exonic
1176566763 21:8392108-8392130 CCCGCCGGCGGCGCGGCGCAGGG - Intergenic
1180066583 21:45415500-45415522 CGCTCCGCCGCCCCTGCGCATGG - Intronic
1180942559 22:19668901-19668923 CGGGCCGCAGGCACAGCGCATGG + Intergenic
1181256845 22:21568153-21568175 CGCGGCGCGGGCTCCGGGCAGGG - Intronic
1181696386 22:24594864-24594886 CGGGCTGCCTGCTCTGGGCAGGG - Intronic
1183819190 22:40331129-40331151 CGTGCTGCCCGCTCTGCACACGG - Exonic
1184735703 22:46396656-46396678 CGCTCCCCCGGCTCCCCGCAGGG - Exonic
954615696 3:51967751-51967773 CGCACCGCCCGCGCTGCGCCCGG + Intronic
961359241 3:126356977-126356999 CGCGCCGCCGCCTCGGTGCCTGG - Intronic
963038301 3:141051147-141051169 CGCGCCGCCGCCTTGGCACAGGG + Intergenic
965615026 3:170585218-170585240 GGGGCTGCCGGCTCTGGGCAGGG + Intronic
968090549 3:195895911-195895933 CGCGGAGCCGGCTGAGCGCAGGG - Intronic
968585619 4:1414767-1414789 CGCGCCCCCGGCTGAGCCCAAGG + Intergenic
968947808 4:3674836-3674858 CCCGCAGCCTGCTCTGAGCAAGG - Intergenic
980130388 4:128811681-128811703 CGCGCCGCGGGCTTTGTGCGGGG - Intronic
983254126 4:165379242-165379264 CGCGCTGCTGGCTCTGTGCGGGG + Exonic
985129310 4:186724713-186724735 CCAGCCGCAGGCTCGGCGCAGGG + Intronic
987050436 5:14143648-14143670 CGTGCCGCCCGCTCCGCGCCGGG - Intergenic
999768430 5:154757004-154757026 CGGGCCGCCGGCGCGGCGCATGG - Intronic
1002280054 5:178124576-178124598 CGGGCAGCCTGCTCTGCGGAAGG + Exonic
1002281075 5:178130595-178130617 CGCGCCGCCCTCACTGAGCAGGG + Intergenic
1006491557 6:34392443-34392465 CGCGCCCCCGGCTCGGCCAAGGG + Exonic
1013575802 6:111482957-111482979 GGCGCCGCCGCCGCTGCGGAGGG - Exonic
1014724885 6:124962361-124962383 CGCGCCGCAGCCTCGGAGCACGG + Intergenic
1017662456 6:156687535-156687557 GGCGCCGCCCGCTCCGCGCCCGG - Intergenic
1034354917 7:150444290-150444312 GGTGCAGCCGGCTCTGGGCAGGG - Intergenic
1035133427 7:156676409-156676431 TGTGCCGCAGGCTCTGCGCCGGG + Exonic
1038444358 8:27593071-27593093 CGCCCCCCCGGCCCCGCGCAGGG - Intergenic
1039454190 8:37696930-37696952 TGCGCCGCAGGCCCTGCGGAAGG - Intronic
1039949052 8:42153416-42153438 GTCGCCGCCGGCTCTGGGCCGGG + Intronic
1044699004 8:94949510-94949532 CGCGCCGCCGGCCGGGCGCCAGG - Intronic
1045063430 8:98426827-98426849 TGCGCCCCCGGCTCGGCGCGGGG - Intronic
1049212250 8:141392164-141392186 CCCGCCGCCCGCTCCGGGCACGG + Intronic
1056386279 9:86099584-86099606 CGCGCCGCCGGCGCTGCTCGGGG - Intronic
1060916951 9:127397490-127397512 CGCGCCCCCGGCCCCGCGCCTGG + Exonic
1062341331 9:136095049-136095071 CGCGCGGCCGGCACTGCGGCAGG + Intronic
1062414102 9:136439311-136439333 CGCTCCGCCGGCCCAGCGCGCGG - Exonic
1062435960 9:136546655-136546677 GGCGCCGCGGCCTCTGGGCAGGG + Intergenic
1062533783 9:137012853-137012875 CGCTGCACCTGCTCTGCGCAGGG - Exonic
1062542737 9:137048773-137048795 CGACCCGCCGGGGCTGCGCAAGG - Exonic
1062567389 9:137169299-137169321 CGCTGCGCCCGCTCTGCGCCTGG - Exonic
1186455832 X:9709146-9709168 CGCGCCACCGGCGCTGCAGAAGG - Intronic
1191213186 X:57910005-57910027 CCCGCGGGCTGCTCTGCGCAGGG - Exonic