ID: 934680355

View in Genome Browser
Species Human (GRCh38)
Location 2:96279199-96279221
Sequence AGTGAGCAGCCCAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 383}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934680355 Original CRISPR AGTGAGCAGCCCAAGGAGGA AGG Intronic
900166718 1:1246900-1246922 AGTGAGGAGGCCAGAGAGGACGG - Intergenic
900167069 1:1248090-1248112 AGTGGGCAGCCCTGGGAGGCTGG + Intergenic
900760888 1:4469399-4469421 AGTCAGCAGCGGGAGGAGGAGGG + Intergenic
901473772 1:9475225-9475247 ATTGAGCAACCCAAGGAAGAGGG + Intergenic
901908627 1:12436375-12436397 AGGGAGCAGTCCCAGCAGGAGGG + Intronic
902079151 1:13809302-13809324 AGTGAGAAGTCCAGTGAGGAAGG + Intronic
902497890 1:16887110-16887132 AGTGAGAGGACCAAGGAGGGCGG - Intronic
902778906 1:18692144-18692166 GCTGGACAGCCCAAGGAGGAGGG + Intronic
903740147 1:25554064-25554086 AGTGAGCACCCCAGTCAGGAAGG + Exonic
903790035 1:25886535-25886557 AGGGAGCAGCACATGGAGGGTGG - Intronic
904045702 1:27607082-27607104 CCTGAGCAGCCCCAGGAGTAGGG - Intergenic
904235522 1:29114183-29114205 AGACTGCAGCCCAAAGAGGATGG + Intronic
904257052 1:29260496-29260518 CGTGAGAGGCCCTAGGAGGACGG + Intronic
904948113 1:34214179-34214201 AGTGAGCAGCACTGGGAGGAGGG + Intronic
904953036 1:34259751-34259773 GGTGAGGAGGCCAAGGAGGGTGG - Intergenic
905150962 1:35927112-35927134 AGTGAGCTGCAAAAGGAGGAAGG + Exonic
905930459 1:41783258-41783280 AGTGAGAAGCCACAGGAGGAAGG + Intronic
906034904 1:42744388-42744410 AGTGAGCCACCCAAATAGGATGG + Intergenic
906165161 1:43680643-43680665 TGTGGGCAGCCCAGGGAGGCTGG - Intronic
907740098 1:57156999-57157021 AGTCAGGATCCGAAGGAGGAAGG + Intronic
912439342 1:109686972-109686994 AGAGAGCAGGCGAGGGAGGATGG - Intronic
912442652 1:109711412-109711434 AGAGAGCAGGCGAGGGAGGATGG - Intergenic
913228010 1:116717536-116717558 AGTGAGAAGTACAAGGAGGTGGG - Intergenic
913380869 1:118208746-118208768 AGTGAGGAGCCAGGGGAGGAAGG + Intergenic
915315069 1:155023876-155023898 TGTGGGCAGCCCCAGGATGAGGG - Exonic
915591658 1:156874400-156874422 GGTGAGTAGCCCAAGGTGGAGGG + Exonic
915937321 1:160097233-160097255 AGGGAGGAGCCCAGGGAGGTGGG - Intronic
915938264 1:160101446-160101468 GGTGAGCAGAGAAAGGAGGAAGG + Intergenic
915991499 1:160521766-160521788 GGAGAGCAGCCACAGGAGGAAGG - Intronic
917979399 1:180259796-180259818 AGTGACAAGCCCAAGGGGAAGGG + Intronic
920646496 1:207807749-207807771 AGTGAGTAGCAGGAGGAGGAAGG + Intergenic
921161434 1:212475020-212475042 TGTGATCAGCACAAAGAGGAAGG + Intergenic
921722822 1:218492344-218492366 GCTGAGCATACCAAGGAGGAAGG - Intergenic
922609155 1:226911532-226911554 AGTGACGAGCCCAAGGCAGACGG - Intronic
922768008 1:228166019-228166041 GGTCAGCAGCCCTAGCAGGAAGG - Exonic
922792734 1:228319027-228319049 AGCGAGCTGCCAGAGGAGGACGG + Exonic
923406562 1:233666790-233666812 AGTGACAAACCCAAGGAGCACGG - Exonic
923439843 1:234006834-234006856 AGTGAATAGCCACAGGAGGAAGG - Intronic
924110439 1:240693540-240693562 AGTGAGAAACCCAACGAGAAGGG - Intergenic
924635953 1:245788062-245788084 AGGGAACAGCGCAAGGAGAATGG + Intronic
924643726 1:245857728-245857750 GGAGAGCAGCCCAAGGGGAAGGG - Intronic
1063662757 10:8045289-8045311 AGTGAGCAGGAGAAGGCGGAGGG + Intergenic
1064591088 10:16891439-16891461 AGAGAGAAAACCAAGGAGGAAGG + Intronic
1064836691 10:19540050-19540072 AATGAGCTGCTCAAGGACGAGGG + Intronic
1067067091 10:43110373-43110395 AGTGAGGAGGCCCAGGAGGCTGG + Intronic
1067766066 10:49088413-49088435 ATTGAGCAGGTCAAGGAGGTTGG - Intronic
1068821279 10:61379327-61379349 TGGGTGCAGCCCAAGGAGCAGGG - Intergenic
1069378915 10:67822225-67822247 AGAAAGCAGCCCAAAGAGGCTGG + Intronic
1069507460 10:69013546-69013568 AACAAGCAGCCCAAGAAGGAAGG + Intronic
1069802392 10:71090177-71090199 ATTGATAAGCCCCAGGAGGATGG - Intergenic
1070356866 10:75648345-75648367 ACTGAGCAGCCCAAGTTGTAGGG - Intronic
1071332588 10:84574642-84574664 AATGAACAGCCCACAGAGGAGGG - Intergenic
1073190385 10:101646651-101646673 AGTGAGAAACCCAGGGAAGAAGG - Intronic
1073204603 10:101762287-101762309 TGAGAGCAGCCCAGGGAGGGAGG - Intergenic
1074624937 10:115172521-115172543 AGAGAGTGGCTCAAGGAGGATGG - Intronic
1075716795 10:124560512-124560534 CCTGAGCAGGCCAACGAGGAGGG - Intronic
1076285349 10:129290204-129290226 AATGAGGACCCTAAGGAGGATGG + Intergenic
1076542743 10:131224342-131224364 AGGCAGCAGACCCAGGAGGATGG - Intronic
1076837604 10:133028961-133028983 AGTGAGCAGTCCCAGGATCAGGG + Intergenic
1078143341 11:8707236-8707258 CGCCAGCAGCCCAAAGAGGAAGG + Intronic
1078915268 11:15772924-15772946 AATGAGGAGCCTAAGGAGGAAGG + Intergenic
1079617628 11:22514507-22514529 AGTCAGCACTCCAAAGAGGATGG + Intergenic
1080135192 11:28845777-28845799 AGTGAGCTGCCCCAGTATGAAGG - Intergenic
1080878317 11:36296499-36296521 AGTATCCAGCCCAAGGAGGATGG + Intronic
1082108488 11:48245654-48245676 AATCAGCAGACCAATGAGGAAGG - Exonic
1083240565 11:61384848-61384870 AGGGAGCTGCCCCAGGTGGAAGG + Intergenic
1083855129 11:65389541-65389563 AGTGAGGAGCCCAGGCTGGAGGG + Intronic
1083904630 11:65662031-65662053 ATTGAGCAGCCCAAGCAGCGGGG - Exonic
1084355459 11:68635374-68635396 AGGGAGCAGCCTGGGGAGGAGGG - Intergenic
1084709010 11:70832509-70832531 AGTGTGCAGGGCAGGGAGGAGGG - Intronic
1085051984 11:73384673-73384695 AGTGAGCAGGCTGAGGGGGAAGG - Intronic
1088257553 11:107915604-107915626 AGTGCTCAGACCAAGGAGCAGGG + Intronic
1089364702 11:117914569-117914591 ACTGAGCAGCCCAAGGACCTGGG + Intronic
1089476934 11:118771611-118771633 AGGGAGAAGGCAAAGGAGGAAGG + Intronic
1089571577 11:119414782-119414804 AGTGATCAGCACTATGAGGAGGG - Intergenic
1089701517 11:120247037-120247059 AGTCAGCAGGCCAAGGTGGGAGG + Intronic
1089953168 11:122548225-122548247 GATGAGCAGCCTAGGGAGGAGGG - Intergenic
1090927036 11:131258544-131258566 TAGGAGCAGCCCAGGGAGGAGGG + Intergenic
1091300966 11:134507985-134508007 AGTTAGCATGCCAGGGAGGAAGG - Intergenic
1091784264 12:3232827-3232849 AGTGAGCAGCCTCTGGAGGCAGG - Intronic
1094271918 12:28626561-28626583 GGTGAACAACCCAAGGAGGTTGG - Intergenic
1094842295 12:34347226-34347248 AGGGGGCAGCCCAAAGAGGCAGG - Intergenic
1094844618 12:34356002-34356024 AGTGGCCAGCCCAAGGCGGCAGG - Intergenic
1094850135 12:34378681-34378703 AGGGACCAGCCCAAGGTGGCAGG - Intergenic
1094854460 12:34396767-34396789 AGTGGCCAGCCCAAGGCGGCAGG + Intergenic
1094870495 12:34596745-34596767 AGGGACCAGCCCAAGGTGGCAGG + Intergenic
1096777401 12:53972750-53972772 TGTGAGCAGCACCAGGAGGGTGG - Intergenic
1099958291 12:89372628-89372650 AGTGAGTAGCCCGAGGAGTTTGG + Intergenic
1102230355 12:111257588-111257610 AGTGAGGAGGAGAAGGAGGAGGG - Intronic
1102827429 12:115961299-115961321 AGTGAGCACCACAAAGTGGACGG + Exonic
1103261404 12:119592403-119592425 AGTGTGCAGTCCAATGAGGGAGG + Intergenic
1104727723 12:131088075-131088097 AGGGAGCAGCCCAGGGGAGAAGG + Intronic
1104835033 12:131784184-131784206 ACTGAGCAGTCCAGGAAGGAGGG + Intronic
1105444695 13:20442948-20442970 AGTGATCAGTCTAAGGAAGAGGG - Intronic
1105450474 13:20494860-20494882 TGTGTGCTGCCCAGGGAGGAAGG - Intronic
1110316094 13:74108803-74108825 ACTGAGTAGGCTAAGGAGGAGGG + Intronic
1111375181 13:87368701-87368723 TGGGTGCAGCCCAAGGAGCAGGG - Intergenic
1112383030 13:98911062-98911084 TGTGAGCAGCCCAGGCAGTAAGG - Intronic
1112718908 13:102219327-102219349 AGGTAGCAGCCCCAGGAGGTAGG - Intronic
1113745754 13:112743137-112743159 AGTAAGCAGATCAAGGATGAGGG - Intronic
1114568510 14:23649488-23649510 ACTGGACAGCCCAAGGAGCATGG - Intergenic
1115548226 14:34482038-34482060 ACTCAGGAGCCCAAGGTGGAAGG + Intergenic
1116971914 14:51075159-51075181 AGTGGGTCGCCCAAGGAGGTAGG + Intronic
1117422640 14:55562101-55562123 ATTGAGTAGGCTAAGGAGGAAGG + Intronic
1117970414 14:61245882-61245904 AGTGAGCAGATCTGGGAGGATGG + Intronic
1118333469 14:64832396-64832418 ACAGAGCAGGCAAAGGAGGAAGG - Intronic
1118787736 14:69060143-69060165 AGTCATCAGCCAAAGGAGAAGGG + Intronic
1119200790 14:72751080-72751102 ACTGAGGAGGCCAAGGTGGAAGG + Intronic
1120094650 14:80374959-80374981 AGTGAGCAGGTCAAGGAGTTTGG + Intronic
1121428708 14:93872175-93872197 AGGGAGCAGCCCAGGGTGGTGGG - Intergenic
1121502089 14:94446120-94446142 ACTGAGCAACCCAATGAGGCAGG + Intronic
1122885477 14:104708570-104708592 AGGAAGGAGCCCAAGGAGGTGGG + Exonic
1125422757 15:39521084-39521106 AGTGAACAGGCCAAGGTGGGTGG - Intergenic
1126117777 15:45224697-45224719 AGTGAGCAGACAAAAGAGGCTGG - Intergenic
1126320657 15:47419275-47419297 AGTGAGTGGCTCAAGAAGGATGG + Intronic
1126567121 15:50112423-50112445 AAAAAGCAGGCCAAGGAGGAAGG + Intronic
1126916587 15:53473039-53473061 AGTGAGCTGCCCCGGGAGGTAGG + Intergenic
1128550367 15:68594440-68594462 GGTGAGCAGCCCTGGCAGGAAGG + Intronic
1128716919 15:69915323-69915345 AGGCTGCTGCCCAAGGAGGATGG + Intergenic
1129356965 15:74997704-74997726 TGTGAGCAGCCAAAGGTGGTGGG + Intronic
1131095900 15:89654362-89654384 AGTGAGTAGTCCAGGGAGGCAGG - Intronic
1131593786 15:93775909-93775931 GGTGAGGAGCCATAGGAGGAGGG + Intergenic
1132955144 16:2587961-2587983 AGAGAGGAGCCCAAGGGGGTGGG + Intronic
1134753712 16:16647891-16647913 AGTTAGTGGCCCCAGGAGGAAGG + Intergenic
1134992347 16:18711152-18711174 AGTTAGTGGCCCCAGGAGGAAGG - Intergenic
1135016463 16:18928059-18928081 AGCAAGGAGCCCAAGGTGGAGGG - Intergenic
1135322103 16:21503907-21503929 AGCAAGGAGCCCAAGGTGGAGGG - Intergenic
1135326216 16:21527361-21527383 AATGGGCAGCCCATGGAGAATGG + Intergenic
1135462777 16:22659612-22659634 ACAGAGCAGGACAAGGAGGAAGG + Intergenic
1135510541 16:23079269-23079291 AGTGATAAGCCCATGGATGATGG + Intronic
1136049505 16:27640407-27640429 AGTGAGCAGCCCAGGCTGGCAGG - Intronic
1136086365 16:27888123-27888145 AGTGAGCAGCGCCATGATGAGGG - Intronic
1136333579 16:29597048-29597070 AGCAAGGAGCCCAAGGTGGAGGG - Intergenic
1136496957 16:30650806-30650828 GGTGAGCAGCCCTTGGGGGAGGG + Intronic
1136577546 16:31133383-31133405 AGGGAGCTGCCCAGGGAGGAAGG + Exonic
1136867369 16:33768744-33768766 AGGAAGCACCCCAAGAAGGAAGG + Intergenic
1138415820 16:56870736-56870758 GGTGAGGAGGCCATGGAGGAGGG + Exonic
1139474617 16:67196846-67196868 GGTGGGCAGCAGAAGGAGGAGGG - Intronic
1140590918 16:76351755-76351777 TGTGAGCAGCGCTAGGAAGAGGG + Intronic
1141175155 16:81713781-81713803 GGTGAGCAGCCCACGGAGGGAGG - Intergenic
1141272159 16:82551150-82551172 AGTGAGCAGCCGAAAAATGATGG - Intergenic
1141426276 16:83946608-83946630 GGTGAGGAGCCATAGGAGGAGGG - Intronic
1141490649 16:84370342-84370364 AGTGTGCAGCGCCAGGAGGCGGG + Intronic
1141685184 16:85566060-85566082 TGTCAGCAGCCCCAGGAGGCAGG - Intergenic
1141831600 16:86512373-86512395 TGTCAGCAGCCCCAGGAGGCAGG + Intronic
1142039263 16:87882088-87882110 AATGGGCAGCCCATGGAGAATGG + Exonic
1142154143 16:88525606-88525628 AGTGAGCAGCACAGGGCTGAGGG + Intronic
1203104791 16_KI270728v1_random:1347459-1347481 AGGAAGCACCCCAAGAAGGAAGG - Intergenic
1203128723 16_KI270728v1_random:1614909-1614931 AGGAAGCACCCCAAGAAGGAAGG + Intergenic
1143163264 17:4885098-4885120 AGTGAGCCTCCCCAGTAGGAAGG - Intronic
1143205056 17:5135546-5135568 TTGGAGCAGCCCCAGGAGGAGGG - Intronic
1144829742 17:18124519-18124541 CGTGAGCAGCACGGGGAGGATGG + Exonic
1145274766 17:21422868-21422890 GGGGAGCAGCCCAAGCAGGAAGG + Intergenic
1145275206 17:21424998-21425020 AGGAAGCAGGCCAGGGAGGAGGG + Intergenic
1145313061 17:21710895-21710917 AGGAAGCAGGCCAGGGAGGAGGG + Intergenic
1145711482 17:26982701-26982723 AGGAAGCAGGCCAGGGAGGAGGG + Intergenic
1146054070 17:29572581-29572603 GGTGAGCAGCACCAGCAGGAAGG - Exonic
1147661047 17:42117319-42117341 AGTGAAGAGGCCGAGGAGGAAGG + Intronic
1148110838 17:45144030-45144052 AGTGAGCAGGCCCCGGGGGAGGG + Exonic
1148157402 17:45431950-45431972 CGAGCGGAGCCCAAGGAGGATGG + Intronic
1149777701 17:59371084-59371106 AGCCAGCAGGCCAGGGAGGAAGG - Intronic
1150285533 17:63951742-63951764 ATGCAGCAGCCCCAGGAGGAAGG + Exonic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152317817 17:79591076-79591098 AGTGAGCAGGCTTGGGAGGAAGG - Intergenic
1152341943 17:79730465-79730487 AGGAAGCATCCCAAGAAGGAAGG + Intergenic
1152899010 17:82929418-82929440 GGTGGGCAGCCCAAGGAGCTGGG - Exonic
1153610021 18:6874855-6874877 ACAGAGCAGCCCAAAGAGGCTGG + Intronic
1155117922 18:22787864-22787886 AGTGAGCAGGCCACTTAGGAAGG + Intergenic
1155176026 18:23302103-23302125 TGTGAGCAGCTCTAGGAGAAAGG - Intronic
1155406008 18:25487833-25487855 AGAGAGCACCCCAAACAGGAAGG + Intergenic
1155904201 18:31429608-31429630 AGTGAAAAGGCAAAGGAGGAAGG + Intergenic
1156522993 18:37737676-37737698 TGTGTACAGCCCAGGGAGGAGGG + Intergenic
1157559923 18:48638833-48638855 GGGGAGGAGCCCAAGGAGGGTGG + Intronic
1157688997 18:49665465-49665487 TCTGAGAAGTCCAAGGAGGAGGG - Intergenic
1157766458 18:50301099-50301121 AGTGAGCAACGCAAGGACCATGG + Intergenic
1158087797 18:53673662-53673684 AGAGAATAGACCAAGGAGGATGG + Intergenic
1159332986 18:67025293-67025315 TGGGAGCAGCCAAGGGAGGAGGG + Intergenic
1159685470 18:71413682-71413704 AGTGAGCAGCCCCTGGATGGTGG - Intergenic
1160868352 19:1266030-1266052 TGTGTGCAACCCAAGGAGGTGGG - Intronic
1161415799 19:4145666-4145688 AGGGAAAAGGCCAAGGAGGAGGG + Intergenic
1161949311 19:7458984-7459006 GGTGCTCGGCCCAAGGAGGAAGG - Intronic
1161958008 19:7506885-7506907 AGGGAGGAGCCAAAGAAGGAGGG - Intronic
1163020407 19:14478294-14478316 GCTCAGCAGCCCAAGGACGATGG - Exonic
1163322571 19:16583212-16583234 AGGGAGAATCCAAAGGAGGAGGG - Intronic
1163900367 19:20095046-20095068 AATGAGCAGCCTGGGGAGGAGGG + Intronic
1164506319 19:28864132-28864154 TGTGAGCTGCCCAGGGACGAGGG - Intergenic
1165073705 19:33269528-33269550 AGTGAGGAGTCCCAGGAGTAAGG - Intergenic
1165450629 19:35880029-35880051 AGTGTGGACCCCAAGGAGGCTGG + Intergenic
1165933598 19:39375823-39375845 AGTGAGCAGACAGAGGAGCAGGG + Exonic
1166102045 19:40576824-40576846 AATGAGCAGCCTATGGAGGCGGG + Intergenic
1166688420 19:44809307-44809329 TGTGGGGACCCCAAGGAGGAGGG + Intronic
1167612411 19:50513847-50513869 AGCGAGCAGCCCAGGGAGCCAGG - Exonic
1168367027 19:55797017-55797039 AGTGAGGAGATCAGGGAGGATGG - Intronic
925373123 2:3361983-3362005 AGGGAGCATGCCAAAGAGGAAGG - Intronic
925595722 2:5553570-5553592 AGAGTCCAGCCCAAGGAGGTGGG + Intergenic
925717276 2:6796081-6796103 AGAGAGCAGCTCAGGCAGGATGG + Intergenic
926234049 2:11026181-11026203 AGGAAGCTGCCCAGGGAGGAGGG + Intergenic
927708504 2:25311383-25311405 AGGGAGCCGCCCAGGGAGGGTGG - Intronic
927719299 2:25372751-25372773 AAAGAGGAGCCCACGGAGGAGGG + Intergenic
928630232 2:33183993-33184015 AAAGAGCAGGCCAAGGAAGAGGG - Intronic
929532657 2:42762415-42762437 AGTGAGCGCCCCAAGGTGAAGGG - Intergenic
932576686 2:72966129-72966151 AGAAAGCTGCCCAGGGAGGATGG - Intronic
934070197 2:88376854-88376876 AGGGAGCAGGCAAAGAAGGATGG - Intergenic
934680355 2:96279199-96279221 AGTGAGCAGCCCAAGGAGGAAGG + Intronic
935726767 2:106030538-106030560 AGTGAGTAAGGCAAGGAGGAAGG + Intergenic
935889205 2:107657655-107657677 AGGGACCACCCCAGGGAGGAGGG - Intergenic
936141914 2:109948048-109948070 GCTGAGCAGCCCAATGAGCAGGG - Intergenic
936178602 2:110245996-110246018 GCTGAGCAGCCCAATGAGCAGGG - Intergenic
936202776 2:110423436-110423458 GCTGAGCAGCCCAATGAGCAGGG + Intronic
936831238 2:116650440-116650462 GCTGAGCAGGCCAAGGAGGAAGG + Intergenic
936870701 2:117131948-117131970 AAGGAGCAGCCTAAGAAGGAGGG - Intergenic
937771309 2:125723487-125723509 AGAGAGCAGGCCAAGCAGAAAGG - Intergenic
937865446 2:126748199-126748221 AGTGAGCAGCCCACGTATGTTGG - Intergenic
937929565 2:127193552-127193574 GGGGAGCAGGCCAAGGAGCATGG + Intronic
942042365 2:172079223-172079245 AGTGATCTACCCATGGAGGAGGG + Exonic
942147592 2:173041962-173041984 AGTTAGCACCACAGGGAGGAGGG - Intronic
942324958 2:174768736-174768758 AGGGAGCAGCCCAGGGAAGGGGG + Intergenic
942455748 2:176137053-176137075 ACTGAGCTGCCCAAGGGGGTCGG - Intergenic
944162311 2:196677276-196677298 ATTAACCTGCCCAAGGAGGATGG - Exonic
946031969 2:216712559-216712581 GGTGAGAAGCCTTAGGAGGATGG + Intergenic
947864209 2:233384872-233384894 CCTGAGCAGGCCAGGGAGGAGGG - Intronic
948210190 2:236187265-236187287 TGTGAGCACCACAAGCAGGAGGG + Intergenic
1169745574 20:8939211-8939233 TGAGAGCAGCACCAGGAGGATGG + Intronic
1170219463 20:13926555-13926577 AGTGAGCTGCCCCAGGAAGGAGG + Intronic
1170394100 20:15907409-15907431 AGAGTACAGCCCAATGAGGATGG + Intronic
1171238122 20:23544422-23544444 CATGAGCAGCCCATGGAGGAAGG + Intergenic
1171347678 20:24478300-24478322 AGGGAGGAGCCCTAGGAGGGAGG + Intronic
1172080491 20:32336968-32336990 AGTTAGCTGGGCAAGGAGGAGGG + Intergenic
1172468060 20:35171863-35171885 AGGAAGCAGCCCAAGGAGAAGGG + Intergenic
1172603685 20:36200592-36200614 AGTGGGCAGGCCATGGGGGAAGG + Intronic
1173029412 20:39341043-39341065 AGTGAGGAGCCCTACTAGGAAGG - Intergenic
1173251695 20:41366977-41366999 AGGGAGCAGCCCCAGGTGGCAGG + Intergenic
1173471762 20:43329495-43329517 AGTCATGAGCCCATGGAGGAAGG + Intergenic
1173622363 20:44446225-44446247 AGGGAGGAGCCCAAGGGGGCTGG - Intergenic
1173701284 20:45074169-45074191 GATGAACAGCCCAAGGAGGAGGG - Intronic
1174092904 20:48063604-48063626 AGAGTGCAGCCCTAGGAAGATGG + Intergenic
1174714870 20:52746895-52746917 AGCAATCAGACCAAGGAGGAAGG + Intergenic
1176271902 20:64239695-64239717 AGAGAGGACCCCCAGGAGGATGG + Intronic
1177380181 21:20330772-20330794 ACTGAGAAGCCCAAGGCTGAGGG + Intergenic
1178357372 21:31920144-31920166 AGGGGGCAGCCACAGGAGGAAGG - Intronic
1178377008 21:32075194-32075216 AAAGAGCTGCCCAAGGAGAAGGG - Intergenic
1179407069 21:41135287-41135309 AGGGAGCAGGCCAACGAGGCAGG - Intergenic
1179722163 21:43322020-43322042 AGGGAGCAGACCAGGGAGGGTGG - Intergenic
1180150136 21:45943168-45943190 AGTCAGCAGTTCCAGGAGGATGG + Intergenic
1180630954 22:17229597-17229619 AGTGAGCAGCTGAGGGATGATGG - Intergenic
1180835826 22:18928920-18928942 CGTGAGAGGCCCAGGGAGGATGG - Intronic
1181500589 22:23313590-23313612 AGTGAGGAACACAAGGAGGTGGG - Intronic
1181678190 22:24471592-24471614 CGTTAGCAGCCCCAGTAGGATGG - Intergenic
1181712097 22:24697153-24697175 CGTGAGAGGCCCAGGGAGGACGG - Intergenic
1182067210 22:27439076-27439098 AGTCATCCGCCCAAGGAGCAAGG + Intergenic
1183122390 22:35740038-35740060 AGTGAGGAGCCCAGGGATGGAGG - Intronic
1184092659 22:42300622-42300644 GGTCAGCAGCCCAAGGGGCAGGG + Intronic
1184300036 22:43553272-43553294 ACTGAGCAGAACCAGGAGGAAGG + Intronic
1184719696 22:46303931-46303953 AGTGAGGAGGCCAGGGAGCAGGG + Intronic
1185218880 22:49618915-49618937 AGTGACCAGCCGTCGGAGGAGGG + Intronic
1185292216 22:50032816-50032838 AGTGTGCTGCCCAGGGTGGATGG - Intronic
1185306091 22:50117570-50117592 AGCGTGAAGCCCAAGGAAGACGG + Intronic
1203285917 22_KI270734v1_random:154219-154241 CGTGAGAGGCCCAGGGAGGATGG - Intergenic
949364356 3:3264549-3264571 ACTGAGCAGCCCAGGCAGGGCGG + Intergenic
949816935 3:8068592-8068614 TGAGTGCAGCCCATGGAGGAGGG - Intergenic
950486258 3:13275686-13275708 AGGGATCAGGCCACGGAGGAAGG - Intergenic
950559853 3:13715077-13715099 ATTGAGGGGCCCAAGGTGGAGGG + Intergenic
950669384 3:14517024-14517046 TACAAGCAGCCCAAGGAGGAGGG + Intronic
951298900 3:20971566-20971588 GATGAGCAGCCTGAGGAGGAGGG + Intergenic
952895346 3:38075087-38075109 CATGAGCAGCCTGAGGAGGAGGG + Intronic
952926763 3:38326093-38326115 AATGAGCAGTCCAAGGCTGAGGG - Intergenic
953027385 3:39153010-39153032 AGGGGGGAGCCCGAGGAGGAAGG + Intronic
954038635 3:47867671-47867693 AGGGAGCAGAGCAAGGAGGTAGG - Intronic
954973798 3:54674368-54674390 AGTGAGAAGGGGAAGGAGGATGG + Intronic
955176053 3:56613886-56613908 ACTGAGGAGACCAAGGTGGAAGG - Intronic
956172565 3:66444185-66444207 CGTGAGCAGCCCAACGTGGCAGG - Intronic
956519252 3:70085475-70085497 ACTGAGCACCCCCAGGTGGAGGG - Intergenic
956743760 3:72295194-72295216 GGTGAGGAGCCTAAGGATGAAGG + Intergenic
959918545 3:111845890-111845912 AGAGAGGTGCCCAAGGAAGATGG + Exonic
961082205 3:124035814-124035836 ACTGGGCTGCCCAAGGAGGAGGG - Intergenic
961381345 3:126498234-126498256 TGTGAGCATGCCAGGGAGGAGGG + Intronic
961714192 3:128847562-128847584 AGTGAGCTGGGCAGGGAGGAAGG + Intergenic
961936227 3:130586787-130586809 AGTGAACAGCCTAAGTAAGAGGG + Intronic
962334192 3:134511226-134511248 AGTGCTCTGCCCAAAGAGGAAGG - Intronic
962377107 3:134867488-134867510 AGTGAGCAGCCCAAGGGCCTAGG + Intronic
963704217 3:148665620-148665642 AATGAGAAGACCAAGGAGGGAGG - Intergenic
963754973 3:149225522-149225544 AATGGGCAGCCAAAGGGGGATGG - Intergenic
965848345 3:172990963-172990985 AGTGAGCAGCAGCAGGAGAAGGG + Intronic
966397564 3:179518502-179518524 AATGAGCAGCCTGGGGAGGAGGG - Intergenic
967856146 3:194119007-194119029 CGTGTGCAGCCCCTGGAGGAAGG - Intergenic
969278323 4:6152047-6152069 AGGAAGCAGGCGAAGGAGGAAGG + Intronic
969370637 4:6729039-6729061 AGGGTGCAGCCCAGGGAGGGGGG + Intergenic
969504906 4:7579534-7579556 GGAGAGCAGCCAAAGGAGGTCGG - Intronic
969654201 4:8486894-8486916 GAGGAGCAGCCCAGGGAGGAGGG + Intronic
973081004 4:45993108-45993130 AGAAAGCAGCCCAGGGTGGATGG + Intergenic
973089976 4:46124129-46124151 AATCAGTAGCCCAAGGAGGCGGG + Intergenic
974253437 4:59419821-59419843 TGGGTGCAGCCCATGGAGGAGGG + Intergenic
979186770 4:117806253-117806275 CGTGACCAGGCCAAGCAGGATGG + Intergenic
979914360 4:126412184-126412206 AGTGGGCAGGCCAGGGATGATGG + Intergenic
980173164 4:129313486-129313508 AGAGAGAAGCCCAATTAGGAGGG - Intergenic
981040158 4:140215161-140215183 AACGAGCAGCCTAGGGAGGAGGG - Intergenic
983516550 4:168663297-168663319 AGTCAGAAGGCCAAGGAGCAAGG + Intronic
983889764 4:173018583-173018605 AGTAAGCAGTTCAAAGAGGATGG + Intronic
984023172 4:174511075-174511097 ATTGAGCTTCCCAGGGAGGAAGG - Intronic
984950501 4:185004398-185004420 AGAGAGCAGACAAAGGAGGGAGG - Intergenic
986269408 5:6218029-6218051 AGTGAACAGCCCTATTAGGAAGG - Intergenic
986309706 5:6543145-6543167 ATGGAGCAGCCCAAGGACCAAGG - Intergenic
986989579 5:13535901-13535923 AGATTGCAGACCAAGGAGGAAGG + Intergenic
987101506 5:14595147-14595169 ACTGAGCAGGCCAGGGAGCAGGG - Intronic
988793642 5:34632346-34632368 ACTGAGGAACCCAAGGTGGATGG + Intergenic
988866297 5:35338843-35338865 AGTCTGCACCCCATGGAGGAGGG - Intergenic
989364526 5:40640693-40640715 AGGCAGCAAGCCAAGGAGGAAGG + Intergenic
991266933 5:64730680-64730702 AGTCATTAGCCGAAGGAGGAAGG + Intronic
991473408 5:66994119-66994141 AGTGAGGAGCACCAAGAGGAAGG + Intronic
992473001 5:77076735-77076757 ACCCAGCAGCCCAAGGTGGAGGG - Exonic
992613089 5:78524223-78524245 ACTGAGCAGCCCAAGGGAAAAGG - Intronic
995614598 5:113946820-113946842 ATTGAGAAGCCAAAGGAGAAAGG - Intergenic
997192136 5:131946867-131946889 AGTGCTCAGATCAAGGAGGAGGG + Intronic
997846857 5:137294412-137294434 AGTGATCTGCCCAAGGATGCAGG + Intronic
997976861 5:138445981-138446003 ACTGAGCCACCCAAGGAGGTGGG + Exonic
998253580 5:140568442-140568464 AGGGAGCTGCCCAACAAGGATGG - Exonic
998526890 5:142850721-142850743 AGTTAGCAGCCTAATGAGAAGGG - Intronic
999564463 5:152841889-152841911 AGTGGGCAGTGCTAGGAGGAAGG - Intergenic
999921746 5:156329140-156329162 AGTAAGCAGCGGAAGGGGGAAGG + Intronic
1000799785 5:165711767-165711789 GGTGAGTAGCACATGGAGGATGG - Intergenic
1001887227 5:175303958-175303980 AATGAGTAGCGGAAGGAGGAAGG - Intergenic
1002087519 5:176785309-176785331 AGTGTGGAGCCCAAGAGGGAAGG - Intergenic
1002441696 5:179267600-179267622 GGAGAGCAGCCCACAGAGGAGGG + Intronic
1002448256 5:179303092-179303114 AGTGGGCAGCCCCTGGAGGGTGG + Intronic
1002942842 6:1733252-1733274 CCTCAGCAGCCCAGGGAGGAGGG + Intronic
1003338407 6:5196546-5196568 AGTGAGCACTCTTAGGAGGAAGG - Intronic
1004828387 6:19449595-19449617 AGTGAACAGCCAAAGGGGAAAGG + Intergenic
1005864274 6:29926605-29926627 GGGGAGCAGCGCAAGGAGGAGGG + Intergenic
1005897693 6:30192024-30192046 TGTGAGCAGCCCAGAGAGGGTGG + Intronic
1006505603 6:34486705-34486727 AGAGAGGGGCCCACGGAGGAGGG - Intronic
1007141456 6:39578699-39578721 AGTGATCACCCCAGGAAGGACGG - Intronic
1007582826 6:42969382-42969404 AGTGAGCTCCCCAAGGGGAAGGG + Intronic
1007785888 6:44279121-44279143 ATGAATCAGCCCAAGGAGGATGG + Exonic
1008189219 6:48433601-48433623 AGTGAGTAGCCCAAAGAGAAAGG + Intergenic
1009548908 6:65060512-65060534 AGAGAGAAGACCAAGAAGGAAGG - Intronic
1010233636 6:73557089-73557111 AGTGACCAGCTCAAAGATGAAGG - Intergenic
1010754380 6:79650327-79650349 ACTCAGTAGCCCAAGGAGGGAGG + Intronic
1010807705 6:80258553-80258575 GGGGAGCAGCCCAAGGGGGCAGG + Intronic
1011755852 6:90497695-90497717 ATTGCCCAGCCCAAGAAGGATGG + Intergenic
1013548791 6:111186819-111186841 AGTAAGCTGCCCAAGGAGAGAGG - Intronic
1015311120 6:131768192-131768214 AGAGAACAGCACCAGGAGGATGG - Intergenic
1016889811 6:148994773-148994795 AGTGAGCAGGGCAAGGAAAACGG - Intronic
1017654802 6:156617434-156617456 AGTGAGCAGCGGAAGATGGATGG - Intergenic
1018101531 6:160445207-160445229 AGGGAGCAGGCCAGGGAGGAAGG + Intronic
1018101859 6:160447240-160447262 AGTGAGGAGCCCAAAGAGACAGG + Intronic
1018474424 6:164125659-164125681 AGAGAGGAGCCAAGGGAGGAAGG - Intergenic
1018686596 6:166308331-166308353 CGGGAGCACCCCCAGGAGGAGGG - Exonic
1018693516 6:166370010-166370032 AGGGAGCAGCCCCAGGAGCATGG + Intronic
1018948246 6:168361902-168361924 ATTGAGGGGCCCAGGGAGGATGG + Intergenic
1019289059 7:241126-241148 AGGGAGCAGCCCCAGGGGCAAGG - Intronic
1019537473 7:1536880-1536902 CGTGACCTGCCCAAGGAGGTGGG + Intronic
1019623608 7:2004173-2004195 AGAGAGCAGCCCAAACAGGGGGG + Intronic
1021137215 7:16980074-16980096 TGTGCTCAGCCCTAGGAGGAAGG - Intergenic
1022178583 7:27896087-27896109 AGAGAGCAGCACAAGGAAGGAGG + Intronic
1022248749 7:28586172-28586194 AGTGAGGACCACAAGGAGCATGG - Intronic
1022532450 7:31075558-31075580 AGTGAGAAGAGCATGGAGGAAGG - Intronic
1023272536 7:38480268-38480290 AGTGACCAGCGCCAGGAGTAGGG + Intronic
1026138209 7:67682009-67682031 AGTGAGCACCCCTAGTAGGGAGG + Intergenic
1026509940 7:71019389-71019411 GCTGGGCAGCCCCAGGAGGAGGG - Intergenic
1031685757 7:124730691-124730713 GATGAGCAGCCTGAGGAGGAGGG - Intergenic
1031712934 7:125072246-125072268 CATGAGCAGCCCAGAGAGGAAGG - Intergenic
1032124941 7:129186958-129186980 TGAGAGCAGCACGAGGAGGATGG + Intergenic
1032282504 7:130515786-130515808 AGTAAGCAGGCCAGTGAGGAAGG + Intronic
1033270503 7:139928962-139928984 AGTTAGCAGGCAAAGGAGAAAGG + Intronic
1033346236 7:140527357-140527379 GGAGAGCAGCCCGATGAGGAAGG + Exonic
1033550496 7:142442778-142442800 AGAGAGAAGCCCAAAGAGCAAGG - Intergenic
1034105924 7:148489836-148489858 AGTGAGCTGCCTAAGGTGGCTGG - Intergenic
1034132738 7:148735458-148735480 AGTGAGCAGGCGAAGCAGGAAGG - Intronic
1035048542 7:155984651-155984673 AGTCAGCACCCCCAGGAGGTAGG - Intergenic
1036180882 8:6584218-6584240 ATTTAGCAGCTCAGGGAGGAAGG + Intronic
1037208520 8:16355700-16355722 ACTGAGCAGACTGAGGAGGAGGG - Intronic
1037217666 8:16477312-16477334 ATTGAGCTGCCCAAGGAAAAAGG - Intronic
1037254450 8:16937093-16937115 ACTCAGGAGGCCAAGGAGGAAGG + Intergenic
1037521730 8:19686446-19686468 AGCGAGCAGTGCAAAGAGGAAGG - Intronic
1037909918 8:22738221-22738243 AGTGAGCAGCGAGAGAAGGAAGG - Intronic
1038455578 8:27670239-27670261 ACTGTGCAGCCCTAGGAAGATGG - Intronic
1039129886 8:34251046-34251068 GGTGAGTGACCCAAGGAGGATGG + Intergenic
1039889199 8:41672858-41672880 AGTGCACAGCCCAGGGAGGCAGG + Exonic
1042544820 8:69942079-69942101 AGCAACCAGCCCGAGGAGGATGG - Intergenic
1042835168 8:73072935-73072957 AGTGAGCAGAGACAGGAGGAAGG - Intronic
1043050485 8:75379144-75379166 AGTGTGCAACCACAGGAGGAAGG - Intergenic
1047530495 8:125669881-125669903 AGCGGTCAGCCCATGGAGGAAGG + Intergenic
1047898082 8:129388947-129388969 AGTGATCAGAGCAAGCAGGAGGG + Intergenic
1049310463 8:141931322-141931344 AGGGGGCAGCCTAAGGAGGAGGG + Intergenic
1049509333 8:143019551-143019573 AGGGAGTAGCCCGAGGAGGAAGG - Intronic
1049599023 8:143498671-143498693 ACCAAGCAGCCCAAGGGGGATGG + Intronic
1057211067 9:93201392-93201414 CGTGAGCACCCCAACCAGGAAGG - Intronic
1058540697 9:106009509-106009531 TGTGAGAAGCGCCAGGAGGAGGG - Intergenic
1060259837 9:122064760-122064782 AGTAAGAAGACAAAGGAGGAGGG + Intronic
1060294623 9:122334881-122334903 ACTGGGCAGCCAAAGGAGCAGGG - Intergenic
1060880293 9:127113307-127113329 AAAGAGAAGCCCAAGGAGCATGG - Intronic
1061418918 9:130462792-130462814 TTTGAGCAGCCCCAGGAGGCAGG - Intronic
1061676997 9:132223188-132223210 AGAGAAGACCCCAAGGAGGAAGG + Intronic
1061894498 9:133640119-133640141 AGAGAGAAAGCCAAGGAGGATGG + Intronic
1186989025 X:15047751-15047773 AATGAGGAGCCCTAGCAGGATGG - Intergenic
1189220100 X:39364199-39364221 TGAGAACAGCACAAGGAGGATGG - Intergenic
1192474910 X:71432041-71432063 AGAGAGAAGACCAAAGAGGATGG + Intronic
1192935953 X:75858669-75858691 AGGGAGCAGCCTGGGGAGGAGGG + Intergenic
1194235559 X:91379516-91379538 CCTGAGGAGCCCAAGGAGGCTGG - Intergenic
1195107656 X:101616499-101616521 AGTGAGAAGCTGGAGGAGGAGGG - Exonic
1198048623 X:132927269-132927291 AGGGAGCAGCCCAGGGAGACAGG - Intronic
1198683638 X:139205602-139205624 AGCGACCAGCCCTAGGAGGAGGG - Intronic
1199539906 X:148947363-148947385 AGGGGGCATCCCAAGGAGGTAGG + Intronic
1199736618 X:150692357-150692379 AGTGAGGAGGGCTAGGAGGAAGG - Intergenic
1201528604 Y:14964971-14964993 TGTGAGCATACCAAGAAGGAAGG - Intergenic
1202266209 Y:23021695-23021717 TGTGTGAAACCCAAGGAGGATGG + Intergenic
1202419202 Y:24655438-24655460 TGTGTGAAACCCAAGGAGGATGG + Intergenic
1202451584 Y:25014646-25014668 TGTGTGAAACCCAAGGAGGATGG - Intergenic