ID: 934681203

View in Genome Browser
Species Human (GRCh38)
Location 2:96285180-96285202
Sequence CTGCTCTGCCAGGGCCTCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 453}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934681203 Original CRISPR CTGCTCTGCCAGGGCCTCCA TGG Exonic
900109344 1:999060-999082 CAGCGCAGCCACGGCCTCCAGGG + Exonic
900378670 1:2373064-2373086 CTGCTCCACCGGGGCCTGCAGGG + Intronic
900602765 1:3510084-3510106 CAGCTCTGGCAGGGCCACCAGGG - Intronic
901005384 1:6169379-6169401 CTGCCCGGCCAGGGCCCCCTCGG - Intronic
901452768 1:9345951-9345973 CCCCTTTGCCAGGGGCTCCATGG + Intronic
901678875 1:10901828-10901850 CTGCTCCATCAGGGCCCCCAGGG - Intergenic
901746400 1:11376679-11376701 CCTCTCTGCCAGAGCCTCCAAGG - Intergenic
902657857 1:17881915-17881937 CTGCTCTGCCAGGGTCTGGGCGG - Intergenic
902869266 1:19303825-19303847 CTGCCCTCCCAGGGTCTCCTCGG - Intergenic
903024575 1:20418229-20418251 CTGCTCCTCTAGGGCCTCCCGGG + Intergenic
903342052 1:22660800-22660822 CTGCTTTTCCAGGGCTTCCAGGG + Exonic
904029584 1:27525899-27525921 CTGCCCATCCAGGGACTCCAGGG + Intergenic
904253637 1:29240950-29240972 CCCATCTGCCAGGGCCACCACGG - Intronic
904405996 1:30288249-30288271 CTGCTCTGCCATCACCGCCAGGG - Intergenic
905813989 1:40933707-40933729 ATGCCCTGCCAGGGCATGCATGG - Intergenic
905912338 1:41662960-41662982 CGGGCCTGCCAGGGCCTCCCTGG + Intronic
906202245 1:43967635-43967657 CTGCTGTGCCGGGGTCTCCATGG + Exonic
906794512 1:48686635-48686657 CTACCCAGCCAGGGCCCCCAAGG + Intronic
906839590 1:49122187-49122209 CTGCTTTGCCTCGCCCTCCATGG + Intronic
907059904 1:51411250-51411272 CTGCTCTGCCTGGGCTTTAAAGG - Intronic
909176665 1:72370533-72370555 CTGCTCTCCCAGTGCTTCCCAGG + Intergenic
911502406 1:98704656-98704678 GTTCTCTGCCAGGGTCGCCATGG - Intronic
911856824 1:102888583-102888605 GTGGTCTTCCAGGGCCTCCTGGG - Exonic
912274498 1:108242097-108242119 CTTCTCTGCCAGCTTCTCCATGG + Exonic
912286769 1:108377761-108377783 CTTCTCTGCCAGCTTCTCCATGG - Intronic
912293721 1:108452244-108452266 CTTCTCTGCCAGCTTCTCCATGG - Exonic
914490540 1:148148116-148148138 CAGCTCTGCCTCGGCCTCCCCGG - Intronic
914750897 1:150534268-150534290 CTGCTCTGCAAGAGACTCCCTGG + Intergenic
914755467 1:150559494-150559516 CTGCTCAGCCTGGGCCCCTAGGG + Intronic
915020472 1:152774650-152774672 ATACTTTGCCAGGGTCTCCAAGG + Intronic
915150285 1:153825358-153825380 CTCCTCTTCCAGGACCTCTAGGG + Intronic
915367622 1:155324515-155324537 CTGCCCTGCTAGGGCCTGTAGGG - Intronic
916018989 1:160776564-160776586 TTGCTCTGCTGGGACCTCCAGGG + Intergenic
917967998 1:180190620-180190642 CTGCTCTGTTCGGCCCTCCAAGG + Intronic
920050329 1:203160962-203160984 CAGCCCTGCCAGGGTGTCCAGGG + Intronic
920200054 1:204254258-204254280 CTGGAATGCCACGGCCTCCAGGG + Intronic
920733954 1:208514181-208514203 ATGCTTTAACAGGGCCTCCAGGG + Intergenic
920816651 1:209340783-209340805 CTCCTTTGCCAGGGTCTCCCAGG + Intergenic
922370043 1:224900899-224900921 CTGCTTTCACAGGACCTCCAAGG + Intronic
922746697 1:228048240-228048262 CTGCTCTCCCAGGGCCTCGAGGG + Intronic
922749866 1:228065261-228065283 GTGGTCTGTCACGGCCTCCAGGG + Intergenic
924501830 1:244645401-244645423 TTTCTCTACCAGGGCCTCAACGG - Intergenic
1063025700 10:2177033-2177055 CTGCTCCGACAGGGGCTCCTCGG + Intergenic
1063239208 10:4150923-4150945 CTTGGCTGCCAGGGTCTCCAGGG + Intergenic
1063348991 10:5337394-5337416 GTGCTCTGCCAGGGGCTCCACGG - Intergenic
1063502042 10:6563939-6563961 CTCCTCTGCAAAGGCCCCCACGG - Intronic
1063607631 10:7536729-7536751 CTGCTGTGCCAGGATCTCCAAGG - Intergenic
1063653684 10:7965508-7965530 CAGCCCTGCCACAGCCTCCAGGG + Exonic
1065186567 10:23174752-23174774 CTGCTCTGAAAGGGCCTGAAAGG + Intergenic
1065588208 10:27240745-27240767 CTGCTCCGCCAGGGTCCCCAGGG - Exonic
1065877099 10:30006933-30006955 CAGCTCAGCAAGGGACTCCACGG + Intergenic
1066534202 10:36372730-36372752 TTGCATTGCCAGGGCCTCCTTGG + Intergenic
1067069312 10:43120399-43120421 CTTCTCCTCCAGGGCCTCCAGGG + Intronic
1067079685 10:43205949-43205971 GTGCTCCATCAGGGCCTCCAGGG + Exonic
1067178849 10:43970110-43970132 CCGCTCAGCCAGGGTCTGCAAGG - Intergenic
1067231170 10:44411696-44411718 CTGCTTTGGCTGGCCCTCCATGG + Intergenic
1067975961 10:51025480-51025502 CTTCTCAGCCAGAGCCCCCAGGG - Intronic
1068755628 10:60649196-60649218 ATGCTCTCCCAGGAACTCCACGG + Intronic
1069552536 10:69374646-69374668 CTGCTCTAACAGGGCCTTTAGGG + Intronic
1069629934 10:69891471-69891493 CTCTTCTGCCACTGCCTCCAGGG - Intronic
1069635692 10:69923527-69923549 CTGCCCTGCCAGGCCCTCCTAGG - Intronic
1070281348 10:75051097-75051119 CTGCTCTCCTAGGCCTTCCAGGG - Intronic
1070305071 10:75234930-75234952 GTGCTCACCCAGGGTCTCCAAGG + Exonic
1070453169 10:76582242-76582264 CCACCCTGCCAGGGACTCCAAGG - Intergenic
1070898431 10:80005968-80005990 CTGATCTGCCAGGGCCTCCCAGG + Intergenic
1071401863 10:85280682-85280704 CTGCTCTGGCTCGCCCTCCATGG + Intergenic
1073487358 10:103828040-103828062 CTGCCGTGCCAGGCCCTGCAGGG - Intronic
1073509562 10:104034706-104034728 CTGGTCCCCCAGGGCCTCGAGGG - Exonic
1074297492 10:112204031-112204053 CTGCTGTGCCATCTCCTCCACGG - Intronic
1074528436 10:114280479-114280501 ATGCTCTGCAAGGCCCTCCCTGG - Intronic
1075486503 10:122826354-122826376 CTGCTTTTCCTTGGCCTCCATGG - Intergenic
1076070032 10:127482022-127482044 CTGCTCTGCTCAGCCCTCCAGGG + Intergenic
1076675484 10:132145594-132145616 GAGTCCTGCCAGGGCCTCCAGGG - Intronic
1076849399 10:133085798-133085820 CTGCTCTGCGAGCCCCTCCCTGG - Intronic
1077048091 11:555058-555080 CTGCACCGACAGGGCCACCAGGG + Exonic
1077050249 11:563268-563290 CTGCGCTGCCACCGCCCCCACGG + Exonic
1077273558 11:1693036-1693058 CTGCTCAGCCAGGGTCTCTAGGG - Intergenic
1077342275 11:2031441-2031463 CTGGGCTGGCAGGGCCTCCTTGG - Intergenic
1077350845 11:2092577-2092599 CTGGTCTTCCAGGGGCCCCAAGG - Intergenic
1077392805 11:2307815-2307837 ATACTCTGCCTGGGTCTCCATGG - Intronic
1077478832 11:2803530-2803552 CAGCTCTGCCAGTGCCTGCAGGG - Intronic
1077699969 11:4432152-4432174 CAGCACTGCCAGGGCATACATGG + Intergenic
1078065886 11:8079359-8079381 CTGCTCTGCTGCGGTCTCCAGGG + Intronic
1078446607 11:11409503-11409525 GTGCTCAGCCAGGTCCTCTAGGG + Intronic
1079096793 11:17516328-17516350 CAGCTCAGCCAGAGCATCCATGG + Intronic
1079948633 11:26773896-26773918 GTGATCTGCCAGGGGCTCCCAGG - Intergenic
1080798055 11:35583843-35583865 CTGCTCTGCCAGGATATCCTGGG + Intergenic
1080867458 11:36207849-36207871 CTGCTCAGAGAGGGCCTCCTAGG + Intronic
1081148573 11:39597312-39597334 TTGCTCTGCCAGTGCCTACTTGG - Intergenic
1082776039 11:57245147-57245169 ATGCTGGGCCAGGCCCTCCAGGG + Intergenic
1082923791 11:58524311-58524333 CTGCTCTTCCTGGGCCCCTAGGG - Intergenic
1083962629 11:66022786-66022808 ATGCTCTTCCAGGACCTCCGTGG - Intronic
1084271748 11:68032849-68032871 CTGCTCTCCCTGAGGCTCCAGGG + Intronic
1084275487 11:68049192-68049214 CTGGGCTGCCAGGGCCGCCTCGG + Exonic
1084526646 11:69702403-69702425 CTGCTCCGCCAGGGAGTCCGGGG + Intronic
1084980972 11:72828595-72828617 CTGGTCTGGAGGGGCCTCCAGGG - Intronic
1085037863 11:73310486-73310508 CTGCCCAGTCAGGGCTTCCAGGG - Exonic
1085454864 11:76660096-76660118 CTGCAGTGCCAGGACCTCCAAGG + Exonic
1089050029 11:115537862-115537884 CTTCTCTGCCCAGGCTTCCAAGG + Intergenic
1089202060 11:116730433-116730455 CAGCTCCGCCATGGCCTCCCCGG + Intergenic
1089376721 11:117999881-117999903 CAGCTCTGCCAGAGTCTGCAGGG - Exonic
1090048883 11:123359868-123359890 CTCCTCTGCCAACGCCTACATGG + Intergenic
1090187009 11:124745658-124745680 CAGCTCCGCCAGGCCCCCCAGGG - Exonic
1090361421 11:126175352-126175374 CTGTGCTGACAGGGCCTCCAAGG + Intergenic
1090422736 11:126586807-126586829 CTGTTCTGCTGGGGCCTCCTTGG + Intronic
1090973632 11:131663657-131663679 CGGCTTTGCCAGGGCTGCCAAGG - Intronic
1091356855 11:134944083-134944105 CTCTTCTCCCAGGGCCTCCCAGG - Intergenic
1202825261 11_KI270721v1_random:86630-86652 CTGGGCTGGCAGGGCCTCCTTGG - Intergenic
1091781144 12:3215305-3215327 CTGCTCTGCCATTGACTCCCTGG + Intronic
1092255519 12:6924981-6925003 TAGCTCTGCCTGGGCCTCCCAGG + Intronic
1092260604 12:6951587-6951609 CTGCCCTGCCTGGGCCGCCCAGG + Exonic
1092261019 12:6953397-6953419 CTCCTCTGCAGGGGCCTCCTGGG - Intronic
1094135447 12:27120279-27120301 CTGCTTTGCCTCGCCCTCCATGG + Intergenic
1095969495 12:47891996-47892018 TTCTTCTGCCAGGGCTTCCACGG - Intronic
1096180470 12:49547882-49547904 CAGCTCTGCCAGGACCTCTGTGG + Intronic
1098052692 12:66471095-66471117 CTGCTCTGCCATGACCTATATGG - Intronic
1098342889 12:69470304-69470326 CGGAGCTGCCAGGGCCTCCAGGG - Intergenic
1098581346 12:72102864-72102886 CTGCTGTGACAATGCCTCCAAGG - Intronic
1100652423 12:96604954-96604976 CTGCTTTGGCTGGCCCTCCATGG + Intronic
1101433540 12:104646056-104646078 CGGCTCAGCCAGTGCCTCCCTGG + Intronic
1102734538 12:115146671-115146693 CTGCTCTGCCAGGATCCCCAGGG - Intergenic
1103324392 12:120110822-120110844 CTGCTCAGCCTGGGCCTGCAGGG + Intronic
1103518844 12:121524515-121524537 CTTCGCAGCCAGGGCCTCAAGGG + Intronic
1104898413 12:132175409-132175431 CTGGTCTCCCTGGGGCTCCAGGG + Intergenic
1104965941 12:132508891-132508913 CTGCTCTGACAGCCCCTCCTGGG - Intronic
1105941792 13:25154167-25154189 CAGCTCTGCCCAGGTCTCCAGGG - Intergenic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1107604820 13:42047741-42047763 TGGCTCTGCCAGGACTTCCAAGG + Intronic
1108865371 13:54917272-54917294 CTGCTTTGGCATGCCCTCCATGG - Intergenic
1111897800 13:94162570-94162592 CTGCTCTGCCTGGAAATCCAGGG + Intronic
1112305945 13:98273777-98273799 AAGCTCTGTGAGGGCCTCCAGGG + Intronic
1113673820 13:112194825-112194847 ATGCCCAGCCAGGGCCTGCAGGG - Intergenic
1113983431 13:114295283-114295305 CAGCTCTGCCACGCCCTGCAAGG - Intronic
1114418317 14:22558734-22558756 GTGTTCGGCCAGGGGCTCCAGGG - Exonic
1115879527 14:37899503-37899525 CTGCTTTGCCGGGAGCTCCAGGG - Intronic
1116388159 14:44358522-44358544 GTGCTTTGCCAGGGGCTCTAGGG - Intergenic
1116436157 14:44897396-44897418 GGGCTCTGGCATGGCCTCCATGG - Exonic
1118328163 14:64795520-64795542 CTCCTGAGCCAGGTCCTCCAGGG + Exonic
1118729347 14:68655638-68655660 CTGCACAGCCAGGGCCTGCCAGG + Intronic
1118766267 14:68911741-68911763 CAGATCTGCAAGGGCCGCCATGG - Intronic
1119099953 14:71870693-71870715 GTTCTGAGCCAGGGCCTCCAGGG - Intergenic
1119480528 14:74955298-74955320 CTCCTGTGCCAGGGGCTCCCCGG - Exonic
1119484626 14:74979562-74979584 CTGCCCAGCCTAGGCCTCCAGGG - Intergenic
1119509074 14:75197042-75197064 GTGCTCTGCCAGGCCCTCTAGGG - Intergenic
1119743094 14:77026911-77026933 CTGCTCCCCCAGGGGCTCCTGGG - Exonic
1120848742 14:89149403-89149425 CTGCTCTGTCAGCTCCTCCATGG - Intronic
1121879140 14:97484334-97484356 CAGCTCTGCCAGGGCTAGCAGGG + Intergenic
1122140556 14:99660517-99660539 CTGCTCTGACAGGGGCCCCTAGG + Intronic
1122343368 14:101043228-101043250 CTCCTCTCCCACTGCCTCCAGGG - Intergenic
1122838945 14:104445252-104445274 CTTCTCTGCCATGGCCTTGAAGG + Intergenic
1202853968 14_GL000225v1_random:38157-38179 TTGCCCCGCCAGGCCCTCCATGG - Intergenic
1123469764 15:20541354-20541376 CTGCTCTGCCCGGCACACCAGGG - Intronic
1123648299 15:22459345-22459367 CTGCTCTGCCCGGCACACCAGGG + Intronic
1123671743 15:22665227-22665249 CTGCTCTGCCAGCATCTTCAGGG - Intergenic
1123730042 15:23136340-23136362 CTGCTCTGCCCGGCACACCAGGG - Intronic
1123748212 15:23333822-23333844 CTGCTCTGCCCGGCACACCAGGG - Intergenic
1124013013 15:25853716-25853738 GTGCTATGCCATGGCCTGCATGG - Intronic
1124280576 15:28357674-28357696 CTGCTCTGCCCGGCACACCAGGG - Intergenic
1124302122 15:28553938-28553960 CTGCTCTGCCCGGCACACCAGGG + Intergenic
1124323785 15:28738453-28738475 CTGCTCTGCCAGCATCTTCAGGG - Intergenic
1124372561 15:29111827-29111849 CTGCCCAGCCGGGACCTCCAGGG + Intronic
1124527677 15:30471694-30471716 CTGCTCTGCCAGCATCTTCAGGG - Intergenic
1124693271 15:31843527-31843549 CTTCTGTGCCAGGGCCTAGAAGG - Intronic
1124770982 15:32536008-32536030 CTGCTCTGCCAGCATCTTCAGGG + Intergenic
1125602706 15:40924232-40924254 CTGATCTGCCAGGAGCTTCAAGG + Intergenic
1126673620 15:51138092-51138114 CTGGTCTCACAGGGCCTCCCAGG + Intergenic
1128141011 15:65301129-65301151 CTGCGCGGCCGGAGCCTCCACGG - Intergenic
1128549252 15:68587340-68587362 CTGGGCAGCCAGAGCCTCCAGGG - Intronic
1128651183 15:69414693-69414715 CCGCCCCGCCTGGGCCTCCAAGG + Intronic
1128809258 15:70558426-70558448 CTGACCTGGCGGGGCCTCCAAGG - Intergenic
1128814436 15:70597238-70597260 CTCCTCTCCCAGGGACACCAAGG - Intergenic
1128983524 15:72202872-72202894 CTGCCCTGCCATGACCTCCCTGG + Intronic
1129722704 15:77886975-77886997 CTCACCTGCCAGGGCCACCATGG + Intergenic
1130317787 15:82810602-82810624 CTGCTCTGCCAGCATCTTCAGGG - Intronic
1131483489 15:92801647-92801669 CTGCTGTGGCCAGGCCTCCAAGG + Intronic
1132302438 15:100784354-100784376 CTGCTGAGCCAGTGCCTCTAAGG - Intergenic
1132729043 16:1351712-1351734 CTCCTCGGCGAAGGCCTCCAGGG + Exonic
1134018793 16:10907450-10907472 CAGCTCTGCCAGGGCCCCGGGGG - Exonic
1134241515 16:12510317-12510339 ATCTGCTGCCAGGGCCTCCACGG - Intronic
1134467485 16:14492263-14492285 CTGCTTTCTCAGGGCCTCCATGG + Intronic
1134662751 16:15996659-15996681 ATGCTCCACCAGGGCCTGCAGGG - Intronic
1134813445 16:17186816-17186838 GTGCTCTGACGGGGACTCCAAGG - Intronic
1135989552 16:27209627-27209649 CTGCACTGCCAGCTCCACCAGGG - Intronic
1136027969 16:27482066-27482088 CAGGTCTGCCAGGGGCTCCTGGG + Intronic
1136185978 16:28589277-28589299 CCAGTCTGCCAGAGCCTCCATGG - Intronic
1136297326 16:29311146-29311168 ACGCTCTGCCAGAGTCTCCAAGG - Intergenic
1136412494 16:30085501-30085523 CAGCTTGCCCAGGGCCTCCAGGG + Intergenic
1136618280 16:31411426-31411448 CTGCTCTCCCGGGGCCCCAATGG - Exonic
1136628676 16:31476921-31476943 CCGCGCTGCCAGGGCTGCCAGGG + Exonic
1136669020 16:31839434-31839456 CTGAGCTGCCAGGTCCACCAAGG + Intergenic
1137585687 16:49663049-49663071 CTCCTCTGCCAGCGCCTGCTTGG - Intronic
1137720876 16:50626635-50626657 GTTGCCTGCCAGGGCCTCCAAGG - Intronic
1138432245 16:56976328-56976350 ACGCTCTCCCATGGCCTCCAGGG + Intronic
1138577457 16:57917204-57917226 CCGCTCAGCCAGAGCCTCCAGGG - Intronic
1139392636 16:66614584-66614606 CCGCTTTGCCAGGGCTTACAAGG - Intergenic
1139429013 16:66901151-66901173 GTTCTGTGCCAGGGCCTCGAGGG + Intergenic
1139432413 16:66918233-66918255 CTCCTCGGCCAGGCCCACCAAGG + Intronic
1139878257 16:70163706-70163728 CTGGCCAGCCAGGGTCTCCAGGG + Intergenic
1140359306 16:74331108-74331130 CTGGCCAGCCAGGGTCTCCAGGG - Intergenic
1140753363 16:78046068-78046090 CCGCCCTGCCAGGGCCGCCGAGG - Intronic
1141421466 16:83920568-83920590 GTGTTCTGCCAGGGCCTCCCAGG + Exonic
1141476675 16:84278670-84278692 CTGCTCTGGGAGGGCCTCTCTGG + Intergenic
1141994533 16:87628128-87628150 CTGCTCTCCCAGGCCCCACAAGG + Intronic
1142711707 17:1727139-1727161 CAGCTCCTCCAGGGCCTGCATGG - Exonic
1143582040 17:7833328-7833350 CTGCTCTCCCGGAGGCTCCAGGG + Intronic
1143633362 17:8151150-8151172 CCACTCTGCCTGGGCCTCCAAGG + Intronic
1143684208 17:8500844-8500866 CTGCTCTGAGAGCTCCTCCAGGG + Exonic
1143971815 17:10801389-10801411 CAGATCTGGCAGGGCCTCGAGGG - Intergenic
1144328434 17:14203935-14203957 GTTCTCTGCCAGGGACCCCATGG + Intronic
1145255599 17:21320561-21320583 CCTCTCTGCCATGGCCTGCAGGG - Intergenic
1145321015 17:21767388-21767410 CCTCTCTGCCATGGCCTGCAGGG + Intergenic
1146140714 17:30365607-30365629 CTGCTTTGCTAGTGCCTTCAGGG - Intergenic
1147000575 17:37359263-37359285 CGGCGCTGCCAGGGCCGCCGGGG + Intronic
1147161000 17:38569390-38569412 CTCCTCTGCCAGTGGCTCTAAGG - Intronic
1148713400 17:49698322-49698344 TTTCTCTGCCAGGGCATCCGGGG + Intergenic
1150157195 17:62863899-62863921 CTGCTCAGCCAGGACGTCAAAGG + Intergenic
1150602511 17:66663095-66663117 ATGCTCAGCCAGGGCCTTCCAGG + Intronic
1151554857 17:74841648-74841670 CTGCCCTGCCAGGGACGCCCTGG - Intergenic
1152361352 17:79834568-79834590 CTGCTCTCCAAAGGCCTCCTTGG + Exonic
1152420719 17:80191554-80191576 CTGTCCTCCCAGTGCCTCCATGG - Intronic
1152683388 17:81681752-81681774 CTGCTAAGCCAGTGCCTTCACGG + Exonic
1152733526 17:81985391-81985413 CTGCCCCGCCCTGGCCTCCAGGG - Intronic
1152816374 17:82410487-82410509 CTGCTCTGAAACTGCCTCCAGGG - Intronic
1152889876 17:82874313-82874335 CTGCACAGCCAGGGCCTCCCCGG + Intronic
1152910420 17:83002242-83002264 CAGCTCAGCCATGGCCTCCGGGG + Intronic
1153470891 18:5444029-5444051 CCCCTCTGCCAAGCCCTCCAAGG + Intronic
1153642677 18:7169962-7169984 ACTCTCCGCCAGGGCCTCCAGGG + Intergenic
1154092843 18:11381150-11381172 CTGCTGTGCCAAGGCTGCCAGGG - Intergenic
1154147067 18:11875186-11875208 CAGCACTGGCAGGGCCTCCATGG - Intronic
1154497810 18:14975218-14975240 CTCTTCTCCCAGGGCCTCCCAGG + Intergenic
1155422702 18:25672586-25672608 CTCCTCTGCCAGGGGCTTCTGGG + Intergenic
1156965888 18:43091569-43091591 CTGCTGTGGCTGGGCCTGCAAGG + Intronic
1158542219 18:58367265-58367287 CTGCTCTGAAAAGGCCTCGAGGG - Intronic
1158558261 18:58492835-58492857 CTGCTGTGCTAGTCCCTCCATGG + Intronic
1160208495 18:76857283-76857305 CTGCTCAGCCAGGACCCCCATGG + Intronic
1160497432 18:79383609-79383631 CGGCTCTTCCAGGCCCTCCCCGG + Intergenic
1160833220 19:1112878-1112900 CTGCTCTGCCCGCGACTCGAAGG + Exonic
1160844601 19:1160902-1160924 CAGCTCTGCCAGGACCACAAGGG + Intronic
1160995075 19:1878705-1878727 CAGCTCTGCCTCGGCCTCCCTGG + Intronic
1161028539 19:2047632-2047654 CTGCTTTCCCACGGCCTCCTGGG + Intronic
1161063116 19:2225159-2225181 CTGTCCTGGCAGGGACTCCAGGG - Intronic
1161087343 19:2341162-2341184 CTGCTCTGACAGGGCTGCGAGGG + Exonic
1161351195 19:3792890-3792912 CTGAGCCGCCATGGCCTCCATGG + Intronic
1161390954 19:4019869-4019891 CAGCCCTGCCAGGGCCTCTGTGG - Intronic
1161542594 19:4861116-4861138 CTGCTCCCTCAGGCCCTCCAAGG + Intronic
1161719980 19:5897286-5897308 GTGCCCTGCCAGGGCCAGCATGG - Intronic
1161811783 19:6475616-6475638 CTCCTCTGCCAAGGACTCCCGGG - Intronic
1161978731 19:7619823-7619845 CAGCTCTGCCAGCTCCTCCCGGG + Exonic
1162027108 19:7900651-7900673 CTCTTCGGGCAGGGCCTCCAGGG - Exonic
1162109661 19:8393325-8393347 CTGATTGGCCAGGGCCTCTAGGG - Intronic
1163105205 19:15119301-15119323 CTGCTCTGCCTGGACTCCCAGGG - Exonic
1163314381 19:16532246-16532268 CTTCTCAGCCACGGCCTCCTTGG - Intronic
1163414557 19:17178188-17178210 CTGCTCTCCCCAGCCCTCCAGGG - Intronic
1163423330 19:17227105-17227127 TTGCTCTCCCAGGCCCTCCTGGG + Exonic
1163519612 19:17784168-17784190 CTGCTCTGCCTGGCGCTGCAGGG - Exonic
1163555951 19:17993032-17993054 CTGCTCTGCCCGGTCCTGCCAGG + Exonic
1163719359 19:18891353-18891375 CTGCCCTGCGAGGACCACCAGGG - Intronic
1164507245 19:28870297-28870319 CTTCTCTGTCAGGGGCTCCTAGG + Intergenic
1164989944 19:32675964-32675986 CTGCACCGCCCTGGCCTCCACGG - Exonic
1165755485 19:38290448-38290470 CCCCTCAGCCAGGGCCTCCATGG - Intronic
1166120131 19:40681309-40681331 CCCCTCTGCCTGTGCCTCCATGG - Intronic
1166343877 19:42153509-42153531 CTGCTGTGCGTGAGCCTCCATGG + Intronic
1166579240 19:43878556-43878578 GTACTCAGCCAGAGCCTCCAGGG - Intronic
1166873622 19:45884716-45884738 CTGCTGGGGCAGGGCCTCCGCGG + Exonic
1167569285 19:50276861-50276883 CTGCTCCGCCAGCTCCCCCAGGG - Exonic
925116386 2:1382023-1382045 CTTCTCTGCCAGTGCCTCCTTGG - Intronic
925367680 2:3322147-3322169 CTCCCCTGGCAGGGCCTCCGTGG + Intronic
926685619 2:15695590-15695612 CTGGTGTGCCAGGGCCTCCTGGG - Intronic
927869629 2:26615394-26615416 CCGCTCTCCCAGGGCATCCTGGG - Intronic
929044509 2:37776811-37776833 CTGCTCAGCCTGGACCCCCAGGG - Intergenic
929460370 2:42098829-42098851 AAGGTCTGCCAGGGCCTCCTAGG + Intergenic
929547718 2:42866567-42866589 CTGCCCTGCAAGGGCTGCCAGGG + Intergenic
929960060 2:46489633-46489655 CTGCTCAGCCCTGGCCTGCAGGG - Intergenic
929991890 2:46797215-46797237 CTGACCTGCCAGGGTCTCCCTGG + Intergenic
931959558 2:67467000-67467022 CTGTTCTCACAGGGCCTACAGGG + Intergenic
932449819 2:71802295-71802317 CTTCCCTGCCAGGGGCTCCCTGG + Intergenic
932957013 2:76364003-76364025 GTGCTTTGCCAGGGACTCCCGGG + Intergenic
933378689 2:81515366-81515388 CTCCTCTGCCTGGGTTTCCATGG - Intergenic
934681203 2:96285180-96285202 CTGCTCTGCCAGGGCCTCCATGG + Exonic
934953136 2:98592930-98592952 CTCCCCTGCCAGGGGCCCCAGGG + Intronic
934978913 2:98824311-98824333 ATACTCTACCAGGGCCCCCAAGG + Intronic
935083031 2:99817196-99817218 CTCCTCTGCCAGGTGCCCCAAGG - Intronic
937250553 2:120521200-120521222 GTGCTCTCCAAGGCCCTCCAAGG + Intergenic
937317535 2:120941507-120941529 CTGCTCTCCCAGGGCCTCCCTGG - Intronic
940887370 2:159001324-159001346 CTGGTGAGCCAGCGCCTCCAGGG + Intronic
943684995 2:190809148-190809170 CAGCTCTGCCACAGCCACCATGG + Intergenic
944888722 2:204093843-204093865 CTGCTCTGGCTAGGACTCCAAGG + Intergenic
945116094 2:206409570-206409592 CTGCTCTGCCATGGCCATTAAGG + Intergenic
947539318 2:230964300-230964322 CTGCTCCGCCCGAGCCTCCGTGG - Intergenic
947829747 2:233130626-233130648 CTGCTCTGCAAGGAGCTCTATGG + Exonic
948262323 2:236613444-236613466 CTGGGCTGCCAGGCCCTCCCTGG + Intergenic
948270947 2:236672721-236672743 CTGCTCTGCCAGGCCAGGCAGGG + Intergenic
948490035 2:238306786-238306808 GGGCTCTGCCAGGGCCTCCAGGG - Intergenic
948559902 2:238845910-238845932 CTGCCCTTCCAGGGCGTCCCCGG + Intergenic
948693329 2:239720493-239720515 CTCCTCTGCCACGGCCTCCACGG + Intergenic
948759682 2:240182929-240182951 CTGCTCCCTCAGGGCCTCCCAGG - Intergenic
949011079 2:241678913-241678935 CTGTGCTGGGAGGGCCTCCATGG - Intronic
1170101748 20:12708739-12708761 CTGCCTTGCCAGGGCCTGAAGGG + Intergenic
1171361294 20:24588198-24588220 CTGCTCTGCAGGTGCCTCCTGGG - Intronic
1172230570 20:33333147-33333169 CTGCCCTGCCAGGGCCACGTGGG - Intergenic
1175246519 20:57585502-57585524 CTCCTCTGCTAGGGCTTCCTGGG + Intergenic
1175339358 20:58218413-58218435 CTGCTCACCAAGGGCCCCCATGG + Intergenic
1175798616 20:61788050-61788072 CTGCTCTGCCTGGTCCCTCACGG - Intronic
1176035761 20:63035720-63035742 CCGCTCTGCCCTGCCCTCCAGGG - Intergenic
1176059116 20:63164507-63164529 CGGCTCTGCCAGAACCCCCAGGG + Intergenic
1176088672 20:63309452-63309474 CTCATCTGCCAGAGGCTCCAGGG + Exonic
1176181701 20:63752503-63752525 CTGCTCTGCCCCGGCCTCCTGGG - Intronic
1176273438 20:64248397-64248419 CGGCTCTGTCAGGGCCTCAGGGG - Intergenic
1178370194 21:32021032-32021054 GTGCTCTGCCCAGACCTCCAGGG + Intronic
1178929546 21:36805508-36805530 CTTGTCTGGCAGGGCCACCAGGG + Intronic
1179391408 21:40995242-40995264 CAGCTCTGTCAGGGTCTCAAGGG + Intergenic
1179535651 21:42049802-42049824 CAACTCTGCCTGGGTCTCCAGGG - Intergenic
1179732094 21:43373749-43373771 GTGCTGGGCCAGGGGCTCCAAGG - Intergenic
1179821358 21:43939206-43939228 ATGCACTGGCCGGGCCTCCAGGG + Intronic
1180985608 22:19902488-19902510 CTGGGCTGGCAGGACCTCCAAGG - Intronic
1181049000 22:20229932-20229954 CAGCTCTGCCAGTGGCTGCATGG + Intergenic
1181121137 22:20669243-20669265 CAGCTCTGCCTCGGCCTCCCCGG + Intergenic
1181334099 22:22116269-22116291 CAGCTCTGCCTCGGCCTCCCTGG + Intergenic
1181626269 22:24124339-24124361 CTCCTCTGCCAGGCCCTCTGAGG + Intronic
1181811308 22:25405245-25405267 CTGCACTGCCCGGGCCGCCGTGG - Intronic
1182034036 22:27183642-27183664 CTGCTCTGCGAAGGCCTGCAGGG - Intergenic
1182150065 22:28021516-28021538 CAGCTCACCCAGGGCCACCAAGG - Intronic
1183186577 22:36294950-36294972 CTGCTCCGCCAGCTCCTCCACGG + Exonic
1183362694 22:37390880-37390902 GGTCTCTGCCTGGGCCTCCAGGG - Intronic
1183410984 22:37655080-37655102 GTGCTCGGGGAGGGCCTCCAAGG + Intronic
1183680953 22:39328868-39328890 CTGCTGTGCGAGGGCCTGCTTGG - Intergenic
1183705120 22:39471173-39471195 CTGCCCTGCCCTGGCTTCCAAGG - Intronic
1183936203 22:41263838-41263860 CTCCTCAGCCTGGGGCTCCATGG + Intronic
1184428670 22:44428340-44428362 CTCCTCTTCCGGGGCCTCCTAGG - Intergenic
1184449614 22:44575243-44575265 CTTCTCAGCCAGAGCCTCCCAGG - Intergenic
1184528093 22:45037270-45037292 CAGCTCAGCCAAGGCTTCCATGG + Intergenic
1184938163 22:47740085-47740107 GTGCCCTGCCAGGGGCTCAATGG - Intergenic
1185060261 22:48602963-48602985 CTGCTCTACCAATGCCTCCTGGG + Intronic
1185141720 22:49106367-49106389 TAACTCTGCCAGGGCCTGCATGG + Intergenic
1185335842 22:50270509-50270531 CCGCTCTGCCACCGCCTCCGAGG - Intronic
949185577 3:1187790-1187812 CTACTGTGCCAGTGCCTCCTGGG + Intronic
950093829 3:10316311-10316333 CTGCACTCCCATGGCCACCAGGG + Intronic
950461406 3:13124443-13124465 CTGCTCTGCAAGGCGGTCCATGG + Intergenic
950468007 3:13166906-13166928 ATGTTATGCCAGGGGCTCCAGGG - Intergenic
950722250 3:14891657-14891679 CTGCTCTGCCAGGAACTACGGGG - Intronic
950863937 3:16174238-16174260 CTGCTCTGCCCTGGCCACCAAGG - Intergenic
950891863 3:16411150-16411172 CTGCTCTCACAGGGACTTCAGGG - Intronic
953454112 3:43028794-43028816 CACTTCAGCCAGGGCCTCCAGGG - Intronic
953881754 3:46694504-46694526 CTGCTCTTCCACGGCCGCCTTGG - Intergenic
953891281 3:46753460-46753482 CTGCTCTGCCAGGTGGGCCACGG - Intronic
954217963 3:49134858-49134880 CTGCTGCTCCAGGGCCTGCAGGG + Intergenic
954333833 3:49904736-49904758 CTGCTCTCCCAGGGCCATAAGGG + Intronic
954627770 3:52032010-52032032 CCTCTCTGCCTGGGCCTCCCTGG + Intergenic
954653964 3:52182624-52182646 CTGCCCTGCCAGGGCAGGCAGGG + Intergenic
955921693 3:63963739-63963761 TTCCTCTGCCAGGCCCTCTATGG + Intronic
961677073 3:128574187-128574209 CTGCTCACCCAGGAGCTCCATGG + Exonic
961773672 3:129268591-129268613 CTGCTCTGCCATGGGCGCCGTGG - Exonic
962532692 3:136298127-136298149 CTGCCCTGACAGGACCCCCAGGG + Intronic
964031038 3:152139186-152139208 CTTTTCTCCCATGGCCTCCATGG + Intergenic
966045208 3:175540450-175540472 AGGCTCTGCCATGGCCTCCAAGG - Intronic
967830542 3:193915651-193915673 CTGCCCAGCCAGGGCCAGCAAGG + Intergenic
968270452 3:197399449-197399471 CGGCTCTCTCAGGGCCTCCAGGG - Intergenic
968609368 4:1550186-1550208 CTGCACTGCCCGGGCCCTCAGGG + Intergenic
968726832 4:2251736-2251758 TTGCTCTGTGAGGGCCCCCAGGG + Intronic
968772394 4:2516038-2516060 CTGCTCTCTTAGGGACTCCAGGG - Intronic
968793968 4:2689777-2689799 CAGCTGCGCCAGGGCTTCCACGG - Intronic
968910133 4:3473321-3473343 CTGCACTGTCACGGCCTCCCCGG + Intronic
969330333 4:6470974-6470996 CTGCGCTCCCCGGGCCTCCGCGG + Intronic
969392400 4:6900597-6900619 CTGCTGTTCCTGGGCCTCCAGGG + Intergenic
969436866 4:7193556-7193578 CTGGTCTACCAGGGACTCCGCGG + Intronic
969564934 4:7971899-7971921 CTGCTCAGCCTGGGCCCCCAGGG + Intronic
969618909 4:8269360-8269382 CTGCTCAGCCATGGCCTCTGTGG + Intergenic
972056943 4:34815228-34815250 CCTCCCTGCCAGGTCCTCCAAGG + Intergenic
973697917 4:53508790-53508812 CTGGTCTGGGAGGGCCTCCCTGG + Intronic
973708089 4:53599715-53599737 CTCCTCTGCCTGGCCCTTCATGG - Intronic
974055052 4:56976475-56976497 CTGCACTGCCAAGGGCTCCGAGG - Exonic
977171520 4:93768209-93768231 GTGCTCTTCCAGGGCCTGCCAGG - Intronic
981003348 4:139850345-139850367 CTGATCTGCCAGGACCTTCCTGG + Intronic
981029395 4:140108878-140108900 CTGCTGTGCCTGGCTCTCCAAGG + Intronic
982189015 4:152834655-152834677 CAGCTCTGCCCCAGCCTCCATGG + Intronic
983503560 4:168527811-168527833 CTGATCTGCCAGGGCCCTCCAGG - Intronic
985724518 5:1508854-1508876 CGTCTCTGCCAAGGCCACCAGGG + Intronic
985758376 5:1732573-1732595 CTGCTCTCTCAGAGCCTGCAGGG + Intergenic
985995553 5:3595388-3595410 CCGCGCGGCCGGGGCCTCCAGGG - Intergenic
988309778 5:29542142-29542164 CTGCTTTGCCTCGCCCTCCATGG + Intergenic
990003502 5:50921639-50921661 CTGCACTGCCCGGGCCCTCAGGG - Intergenic
990996455 5:61736876-61736898 CAGTTGTGCCAGGGTCTCCATGG - Intronic
992658153 5:78930896-78930918 CTGCGTTCCCAGGCCCTCCACGG + Intronic
993489345 5:88527178-88527200 CTGGTCTGCCTTGTCCTCCAAGG - Intergenic
995237698 5:109849059-109849081 CTGCCTTGCCAGGGCTTCTATGG + Intronic
997271360 5:132540986-132541008 CCTCTCTGCCAAGGCCTGCAGGG - Intergenic
997309284 5:132866477-132866499 CGGCCCGGGCAGGGCCTCCAAGG + Intronic
998179447 5:139926219-139926241 CTGCTCTGCCAGGGTCAGCATGG + Intronic
998267475 5:140677034-140677056 CAGGTCTCCCAGGCCCTCCAAGG + Exonic
999256867 5:150214462-150214484 CTGCCCTGGAAGGGCATCCAGGG + Intronic
999583743 5:153067776-153067798 CTTATCTGTCTGGGCCTCCAAGG - Intergenic
1000767093 5:165305555-165305577 CTGCTCTGACAGGCCTTCCTTGG - Intergenic
1001522233 5:172403013-172403035 CTCCTTGGCCAGGGCCTCCCTGG + Intronic
1001551174 5:172603119-172603141 CTGCCCGGCCAGGGGCCCCAAGG - Intergenic
1001574312 5:172751926-172751948 CTGCCCTACCAGTGCCTACAGGG + Intergenic
1002102693 5:176865182-176865204 CTGCTGTGGCAGGTCCCCCAGGG + Intronic
1002177452 5:177409316-177409338 CTCCTCTGCCTGGGCCTTCCGGG + Intronic
1002195233 5:177497549-177497571 CTGCTCTGCGTCGGGCTCCAGGG + Exonic
1002299089 5:178247542-178247564 CTCCTCCTGCAGGGCCTCCAGGG - Exonic
1002433549 5:179218170-179218192 AAGCACTGCCAGGGCCTGCAGGG + Intronic
1003174768 6:3746413-3746435 GTGCCCTGCCAGGGCTCCCATGG - Intronic
1003400514 6:5786806-5786828 CTGCTGACCCAGGGTCTCCATGG + Intergenic
1003556001 6:7141034-7141056 CGGCCCTCCCAGGGCCTCGAGGG + Intronic
1005946936 6:30602182-30602204 TTCCTCCGCCAGGGCCTTCATGG + Exonic
1005947094 6:30602665-30602687 CTGGCCCACCAGGGCCTCCATGG + Exonic
1005983518 6:30855658-30855680 CTGCTCTGCCATTGCATCGAGGG - Intergenic
1006246808 6:32744296-32744318 CTGCTCTGCCCTGGCATCCTCGG + Intronic
1006444853 6:34074410-34074432 CTGCCCTGGCAGGTCCTCCAAGG - Intronic
1006470640 6:34226876-34226898 CTGCTCTTCCAGGGAGTCCCGGG + Intergenic
1006516946 6:34550468-34550490 CTGCTTCCCCAGGGTCTCCAAGG + Intronic
1007323097 6:41041190-41041212 CTGGTCTGCCAGACCCTCCTTGG - Intronic
1007783893 6:44269628-44269650 CTGCTGTGCCAGGGGATACAGGG + Intergenic
1008555365 6:52668681-52668703 CTGCTCAGGCAGGGCCTCACGGG - Intergenic
1008602856 6:53112620-53112642 CTACTCCCCCTGGGCCTCCAGGG + Intergenic
1010841999 6:80657565-80657587 GTGATTTGCCAGGGCCTCTAGGG - Intergenic
1012225588 6:96699874-96699896 CTATTCTCCCAGGGCCTCCCAGG - Intergenic
1013980125 6:116120583-116120605 CTGGTCTTCCAGGGCCCCCTGGG - Exonic
1017935340 6:159000077-159000099 CTGCTCTTCCAGGGTGTCCTCGG + Exonic
1018646959 6:165957889-165957911 ATTTTCGGCCAGGGCCTCCATGG - Intronic
1018673001 6:166194983-166195005 CTGCACTCCCTTGGCCTCCAGGG - Intergenic
1018774177 6:166998745-166998767 CTGCTCGGCCACGGCCTCCGAGG - Intergenic
1019298601 7:291499-291521 CTGAACTGCAGGGGCCTCCAGGG - Intergenic
1019589883 7:1825675-1825697 CAGCTCTGCACGAGCCTCCACGG + Intronic
1019657174 7:2202037-2202059 CTGCTGTGACAGGGCCCCCCTGG - Intronic
1019728615 7:2617292-2617314 CAGCGCTGCCAGGGCTCCCACGG + Intergenic
1020702331 7:11499012-11499034 CTCCTTTGACAGAGCCTCCAGGG + Intronic
1023088754 7:36598306-36598328 CTGGTCTGCCTGGGCCTTCCAGG - Intronic
1023818333 7:43966507-43966529 CTGCTGTGGCAGAACCTCCAAGG - Intergenic
1023908581 7:44538748-44538770 CTGGGCTGCCATGGCCTCCTGGG - Intronic
1024152883 7:46590863-46590885 CTGCTTTGGCTGGCCCTCCATGG - Intergenic
1028559279 7:92155785-92155807 CTGGTTTGCCAGGGGCTCTAGGG - Intronic
1029595240 7:101534140-101534162 CTGCACTGCCTGGCCCCCCAGGG + Intronic
1029742963 7:102501339-102501361 CTGCTGTGGCAGAACCTCCAAGG - Intronic
1029760953 7:102600500-102600522 CTGCTGTGGCAGAACCTCCAAGG - Intronic
1032388691 7:131541743-131541765 GTCCCCTGCCAGGGCCTGCAGGG + Intronic
1034478741 7:151303753-151303775 CTGCGCTGAAGGGGCCTCCAGGG - Intergenic
1034978443 7:155461096-155461118 GTGCAGTCCCAGGGCCTCCAAGG + Intronic
1034996356 7:155579786-155579808 CTGTTCTGCCCTGGCCTCCTCGG - Intergenic
1035056316 7:156039050-156039072 GGGCACTGCCAGGGTCTCCAGGG - Intergenic
1035562186 8:614013-614035 CTGCAGTGCCAGTGCCTCCTGGG - Intergenic
1035567225 8:649719-649741 CTGCTCAGCCAGGGGCCACAGGG - Intronic
1035812495 8:2504403-2504425 CTGCTGTTCCAGGGCCTCCCTGG + Intergenic
1036608479 8:10329289-10329311 CTGCTCCCCCAGGGGCTCCAGGG + Intronic
1037393021 8:18414605-18414627 CTGCTATGCCAGAGCCTCATTGG + Intergenic
1037515763 8:19630033-19630055 TTGCTCTGCCATAGCATCCATGG - Intronic
1037628597 8:20631301-20631323 CAGCACAGCCAGGGGCTCCAAGG + Intergenic
1037981162 8:23255302-23255324 GAGCTCTGACAGGGCCACCACGG - Exonic
1038384249 8:27127031-27127053 ATTCTCTGCCTGTGCCTCCATGG + Intergenic
1038411587 8:27363286-27363308 CTGCTCTCCCAGGCCTTCCCTGG - Intronic
1040663049 8:49597843-49597865 GTTTTCTACCAGGGCCTCCAGGG - Intergenic
1040977826 8:53214182-53214204 CTGCTGTGCTAGAGGCTCCACGG + Intergenic
1044830667 8:96244740-96244762 CAGCTATGCCAGTGCCTTCAAGG + Intronic
1045493544 8:102688991-102689013 CTGCTCTGCCAGGGCGTCTGAGG - Intergenic
1045498138 8:102725667-102725689 CAGCTTTGTCAGGGCCACCAAGG - Intergenic
1047513641 8:125534722-125534744 CTGCTATGCCAGGCCCTGCTGGG - Intergenic
1047777127 8:128081665-128081687 CTGCTCTTCTATGGCTTCCATGG + Intergenic
1047994811 8:130324164-130324186 CGGTTCTGGCAGGGCCTCCCTGG + Intronic
1048419167 8:134260399-134260421 CTCCTCTCCCAGGGCCTCCCTGG + Intergenic
1048457497 8:134591371-134591393 CTTCACAGCCAGGGCCACCATGG + Intronic
1049207344 8:141369699-141369721 CACCGCTGGCAGGGCCTCCAAGG - Intergenic
1049275630 8:141718781-141718803 CTGCTCTGCCAGAGCATCTTGGG - Intergenic
1049291487 8:141805281-141805303 CTGCACTGCCAGGCTCTCCGGGG - Intergenic
1049614957 8:143572045-143572067 CCGCTCGCCCCGGGCCTCCAGGG + Exonic
1049653712 8:143788645-143788667 CTCCTGTGGCTGGGCCTCCAAGG - Intergenic
1049682382 8:143925306-143925328 CAGCTCCTCCAGGGCCTGCAGGG + Exonic
1049720382 8:144112827-144112849 CTGCCCTCCCAGCGCCTCCACGG - Intronic
1049776178 8:144406408-144406430 CTGCCTTCCCTGGGCCTCCAGGG + Intronic
1049799132 8:144509686-144509708 CTGCACAGCCAGCGCGTCCAGGG - Exonic
1050766595 9:9142196-9142218 CTGCTCTTCTAGGGCTTCTATGG - Intronic
1051663995 9:19451128-19451150 CTGCTCTGCCATGGCCATTAAGG - Exonic
1052174310 9:25439004-25439026 GTGGTTTGCCAGGGGCTCCAGGG - Intergenic
1053141351 9:35684732-35684754 CTTGTCCGCCTGGGCCTCCAGGG + Intronic
1053169354 9:35867806-35867828 CTGCCTTGCCCTGGCCTCCATGG - Intergenic
1054464179 9:65483150-65483172 CTGCTCTGCCCGGCTTTCCAAGG - Intergenic
1055640437 9:78315199-78315221 CTGCTTTGCCAGGGGCTGCAGGG - Intronic
1057139166 9:92716452-92716474 CTGCTCTGGCACGTCCTGCAGGG + Intronic
1057696292 9:97325023-97325045 CTGATCTGCCAGAGTCTCGAAGG - Exonic
1057847119 9:98534143-98534165 CTGCCCTTTCAGGCCCTCCAGGG - Intronic
1060214997 9:121733600-121733622 CTGCCCTGCCAGGCCTTCCTTGG - Intronic
1060412823 9:123411288-123411310 CTGCCCTGCCAGGCCTTCCTTGG - Intronic
1060518762 9:124282187-124282209 GTGCTTTGTCAGAGCCTCCACGG - Intronic
1060822467 9:126669386-126669408 CCTCTCTGCCTGGGCCTCCCTGG + Intronic
1061129954 9:128703079-128703101 CTGCTCTGCGAGGGCGTCGCGGG - Intronic
1061451023 9:130667018-130667040 TTGCTCTGCCAGGGTGTCCGGGG - Intronic
1061781488 9:132999065-132999087 CAGCTGGGGCAGGGCCTCCAAGG + Intergenic
1062133925 9:134914774-134914796 CTGCCTTTCCAGGGGCTCCAGGG + Exonic
1062363630 9:136198850-136198872 CGGCTCTGCGGGGGCCCCCAAGG + Intronic
1062384465 9:136303716-136303738 CTGCTCTCCCTGGGGCCCCATGG + Exonic
1062421823 9:136486286-136486308 CTGCTCTGCTGGGGGCTCCCTGG - Intergenic
1062422326 9:136488781-136488803 CTGCTCTGCCAGCGCCCCACAGG - Intergenic
1062443001 9:136579412-136579434 CTGCCCTGCCAGGGCTGCCCTGG - Intergenic
1062618487 9:137408617-137408639 CTGCTCAGCAAGGCCCTCCAGGG + Intronic
1185894140 X:3843441-3843463 CTCCTCTGCCACGGCCGCCTGGG + Exonic
1185899259 X:3881865-3881887 CTCCTCTGCCACGGCCGCCTGGG + Intergenic
1185904376 X:3920294-3920316 CTCCTCTGCCACGGCCGCCTGGG + Intergenic
1188225425 X:27592019-27592041 CTGCTGTGCCAGGACCTGCCAGG - Intronic
1189328828 X:40130378-40130400 CCGCTCTGCCAGGGATTCCGGGG + Intronic
1190436467 X:50430635-50430657 CTTCTCTGCAAGGGCTGCCATGG - Intronic
1192168794 X:68841860-68841882 CTGCTCTGGGAGTGCCTGCAAGG - Exonic
1192571338 X:72208548-72208570 CTGTTCTGCCAACTCCTCCAAGG + Exonic
1195610601 X:106862980-106863002 CTGCTCTGCCAGAGAGGCCAAGG + Intronic
1198034047 X:132783561-132783583 TTGCCCTGCCAGGGACCCCAGGG - Intronic
1198102278 X:133432575-133432597 CTGCACTGCAAGGGGCTTCAGGG + Intergenic
1200233984 X:154459490-154459512 CTGCTCAGCCACAGCCTGCATGG - Intronic
1200837931 Y:7750956-7750978 CTGCTCTCACAGGGGCTGCAGGG - Intergenic