ID: 934681239

View in Genome Browser
Species Human (GRCh38)
Location 2:96285457-96285479
Sequence GAGTGCAGACAGAGGAGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 320}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934681239 Original CRISPR GAGTGCAGACAGAGGAGCTA AGG Intronic
902632383 1:17712829-17712851 GAGAGCAGCCAGAAGACCTAAGG - Intergenic
902818131 1:18927590-18927612 GTGGGCAAACACAGGAGCTAGGG - Intronic
902885181 1:19399645-19399667 GAGTACAGAGGGAGGAGCTCAGG + Intronic
903132451 1:21289210-21289232 CAGTGTAGAAAGAGGAGCTGGGG - Intronic
903533691 1:24052307-24052329 GGCTGGAGCCAGAGGAGCTAAGG - Intergenic
905464567 1:38143119-38143141 GAGTTCATTCAGAGGAGCAATGG - Intergenic
905916459 1:41688013-41688035 GAGTGCAGATGGAGGAACGATGG + Intronic
906714288 1:47955495-47955517 GAGATCAGACTGAGGAGATAAGG - Intronic
907443318 1:54491387-54491409 GAGTGCAGAGAGAGGAGTAGAGG + Intergenic
913302438 1:117386574-117386596 GGGTGCAGACAGTGAAGCAAAGG - Intronic
913601876 1:120429091-120429113 GTGTGCACACAGGGGAGCCAGGG - Intergenic
914085167 1:144447512-144447534 GTGTGCACACAGGGGAGCCAGGG + Intronic
914244234 1:145873734-145873756 GAGAGCAGGCGCAGGAGCTAGGG - Exonic
914363059 1:146952730-146952752 GTGTGCACACAGGGGAGCCAGGG - Intronic
914488619 1:148134409-148134431 GTGTGCACACAGGGGAGCCAGGG + Intronic
914588985 1:149089490-149089512 GTGTGCACACAGGGGAGCCAGGG + Intronic
915357564 1:155264675-155264697 GAGTGGAGACAATGGTGCTATGG + Exonic
915382675 1:155456759-155456781 GCATGCAGACAGAGTAGATAAGG - Intronic
916600782 1:166291438-166291460 GAATTCAGACAGAAGAGCCATGG + Intergenic
917964855 1:180172040-180172062 GAGAGCAGTCTGAGGAGCAAGGG + Intronic
918375921 1:183908943-183908965 CAGTGAAGACAGAGGATCCAGGG - Intronic
920395902 1:205645762-205645784 GAGTCCAGAAAGAGATGCTAAGG + Intergenic
920947920 1:210546887-210546909 GAGTGGAGACAGAACAGCTTGGG + Intronic
920952391 1:210584718-210584740 GAGTGAAGACAGTGGGGCAAAGG - Intronic
921936356 1:220800539-220800561 GAGTGCAGACAAATGAGAAAGGG - Intronic
922551365 1:226496971-226496993 GAGGGCAGGCAGGGGAGCTGTGG + Intergenic
924392565 1:243579171-243579193 GAATGGGGACAGAGGAGCAATGG + Intronic
924563176 1:245173830-245173852 AAATGCAGAGGGAGGAGCTAAGG - Intronic
1063576020 10:7262664-7262686 GACTGCAGACAGCGGAGCTCAGG + Intronic
1063761295 10:9081267-9081289 GAATGCAGAAAGAGGAGAGATGG - Intergenic
1064256497 10:13746917-13746939 TAGGGCCGACAGATGAGCTATGG + Intronic
1064321237 10:14306898-14306920 GAGAGAAGGCAGAGGAACTAAGG + Intronic
1065634400 10:27715833-27715855 AAGGGCAGACAGAGGACCTATGG + Intronic
1066362942 10:34748547-34748569 GAGTGCTTACAGAGGAGCGAGGG - Intronic
1067687827 10:48478425-48478447 GTGGGCAAACAGAGGAGCAAAGG + Intronic
1068814173 10:61291238-61291260 GAGTGGAGACAGAAGAGCCCAGG + Intergenic
1071688796 10:87793118-87793140 GAGGAAAGACAGAGGAGTTAAGG + Intronic
1071770080 10:88719398-88719420 GAGTTGAGACACAGGAGCTGTGG + Intergenic
1072628486 10:97129715-97129737 GAGTGAAGACAGCAGAGCTGGGG - Intronic
1074272088 10:111964249-111964271 GAGTGCAAACTCAGGAGCTCAGG + Intergenic
1075852455 10:125600317-125600339 GAGTAGAGACTGGGGAGCTAGGG + Intronic
1076579952 10:131500656-131500678 TAGTGCAGACACAGGTGCTATGG - Intergenic
1080276065 11:30504586-30504608 GAGTGCAAACTGTGGAGCCAAGG - Intronic
1083193263 11:61067918-61067940 GAGCACAGACAGAGGAGCTGTGG + Intergenic
1083446698 11:62712607-62712629 CAGTGCAGCCACAGGAGATAGGG + Intronic
1084107090 11:66987325-66987347 GAGTGCAGACAGAGGCTCAGAGG + Intergenic
1085731350 11:79001829-79001851 GTTTGCTGACAAAGGAGCTATGG - Intronic
1086067398 11:82760749-82760771 TTGTGGAGACAGAGGTGCTATGG + Intergenic
1087104767 11:94398447-94398469 TAGTGCAGACAGAGGGACCAGGG - Intronic
1087554906 11:99705732-99705754 GAATGCAGAAAGAGGAGCAGGGG + Intronic
1087804679 11:102543155-102543177 GAGTCTAGACAGATGTGCTAAGG - Intergenic
1087949455 11:104202737-104202759 GAATCCAGATAGAGCAGCTATGG - Intergenic
1089224161 11:116901589-116901611 AAGTACAGACAGAGTAGATAGGG - Intronic
1089443042 11:118531920-118531942 AAGTGCAGACAGGGGAGAGAGGG - Intronic
1089637868 11:119827852-119827874 GAGAGCACAAAGAGGAGGTAGGG + Intergenic
1090994395 11:131852229-131852251 GAGGACAGACAGATGATCTATGG + Intronic
1091783104 12:3226136-3226158 GAGTGCAGAGGGAGGAGATGGGG + Intronic
1093731203 12:22567827-22567849 GTTTGCAGACAGCAGAGCTAAGG - Intergenic
1094190950 12:27697968-27697990 CAGTGCAGAGACAGCAGCTAGGG - Intergenic
1095051406 12:37557806-37557828 GGGTGGAGACAGAGAAACTAAGG + Intergenic
1095054729 12:37585408-37585430 GGGTGGAGACAGAGAAACTAAGG + Intergenic
1095568711 12:43657110-43657132 GACTGGAGACTGAGTAGCTAAGG + Intergenic
1096587781 12:52634329-52634351 GGAGGCAGACAAAGGAGCTATGG - Intergenic
1097770835 12:63582853-63582875 TGGAGCAGGCAGAGGAGCTAGGG + Intronic
1098121445 12:67244419-67244441 GACTGCAGAAAAAGGAGCTCTGG + Intergenic
1098121542 12:67245645-67245667 GAGAGCAGAAAGAGGAGCCCTGG - Intergenic
1102319849 12:111923284-111923306 GATTGCTGACAAAGGAGCAAAGG + Intergenic
1103734308 12:123049423-123049445 GAGTGGCGATGGAGGAGCTATGG - Intronic
1104087990 12:125493427-125493449 GAGTGGAGACAGAGGATGCAGGG + Intronic
1104915568 12:132262682-132262704 AGGTGCAGACAGATGAGCTATGG - Intronic
1104915584 12:132262759-132262781 AGGTGCAGACAGATGAGCTATGG - Intronic
1112261144 13:97879637-97879659 GAGTGAAGCTAGAGGAGCCAGGG - Intergenic
1113398257 13:109968721-109968743 CAGGGGAGACAGAGAAGCTACGG + Intergenic
1113542587 13:111120857-111120879 GAGTGCAGCCAGATGACCTGGGG - Intronic
1113633903 13:111906975-111906997 AAGTGCAGACAGGGCAGCCACGG - Intergenic
1113743427 13:112726217-112726239 GCGTGCAGGGAGAGGAGCCAGGG + Intronic
1114999210 14:28401331-28401353 GAGTGCAGACAGATAAGAGAAGG + Intergenic
1116049105 14:39781598-39781620 GAGGGCAGTCAGAGGAGCAGGGG - Intergenic
1116928866 14:50669927-50669949 GAGAGTAGACAATGGAGCTAAGG + Intergenic
1117224498 14:53640652-53640674 AAGAGCAGACAGAGAAGCGAAGG - Intergenic
1118739313 14:68727570-68727592 GAGGGCAGAGAGAGGAGAAAAGG - Intronic
1119491918 14:75041946-75041968 GAATACTGACAGAGAAGCTATGG + Intronic
1119651198 14:76384692-76384714 GAATGCAGCCAGAGGAACCAAGG - Intronic
1119719136 14:76879497-76879519 GAGTGCGGACAGAGAAGAAAAGG + Intergenic
1120781972 14:88493629-88493651 GACTGCATACAGATGAGATAGGG + Intronic
1121100238 14:91245285-91245307 GAGCGAAGGCAGTGGAGCTAAGG + Intronic
1121219496 14:92275074-92275096 GAGTGGAGAGAGAGGAGGCAGGG - Intergenic
1121328514 14:93035491-93035513 CAGTGCAGACTGATGTGCTATGG + Intronic
1122791092 14:104184499-104184521 GAGTGCTGGCAGAGGAGCGTTGG + Intergenic
1123423376 15:20148736-20148758 GACTGCAGACAGAGGAGTGGAGG + Intergenic
1123532597 15:21155257-21155279 GACTGCAGACAGAGGAGTGGAGG + Intergenic
1124380652 15:29162217-29162239 GAGGGCAGCCAGAGGAGCGAGGG + Intronic
1124658734 15:31528248-31528270 GAATGGAGACATAGGAGCAAAGG + Intronic
1124843256 15:33264424-33264446 GAGTGCAGACTGGGGGCCTAAGG - Intergenic
1125460138 15:39898629-39898651 GAGTGTAAAGAGACGAGCTAGGG + Intronic
1125735050 15:41919026-41919048 GAGTGCAGAGCCAGGAGCTAGGG + Intronic
1128323770 15:66709900-66709922 ATGTGCAGAAAGAGGATCTAGGG - Intronic
1128335837 15:66785278-66785300 GAGTTCAGACAGAAGGGCCAAGG - Intergenic
1128432248 15:67608290-67608312 GAGAGCACCCAGAGGAGCAATGG + Intronic
1128920482 15:71605820-71605842 AAGTGTAGACAGAGGAGAGATGG + Intronic
1129738625 15:77979156-77979178 GGCTGCAGACTGGGGAGCTAGGG - Intergenic
1129847447 15:78774458-78774480 GGCTGCAGACTGGGGAGCTAGGG + Intronic
1130254456 15:82319454-82319476 GGCTGCAGACTGGGGAGCTAGGG - Intergenic
1130600509 15:85270516-85270538 GGCTGCAGACTGGGGAGCTAGGG + Intergenic
1131171759 15:90184180-90184202 GAGTGGAGAGGGAGGAGCCAAGG + Intronic
1131931137 15:97443145-97443167 GAGTCCAGGCAGAGGGGCTCTGG - Intergenic
1134322692 16:13178133-13178155 GGGCACAGACAAAGGAGCTAGGG + Intronic
1134655854 16:15948145-15948167 AGGTAGAGACAGAGGAGCTAGGG - Intergenic
1135464648 16:22674971-22674993 GAGTGGAGTCAGGGGAGCCAAGG + Intergenic
1135992167 16:27224726-27224748 GAGTCCAGACTGGGGAGCTGGGG + Intergenic
1136512593 16:30748464-30748486 GGGGGCAGGCAGAGGAGCCAGGG - Exonic
1137602906 16:49768707-49768729 GACTGAATACAGAGGAGCTGAGG - Intronic
1138165322 16:54796074-54796096 AAGTGAAAACAGAGGAGCCAGGG + Intergenic
1138349972 16:56341240-56341262 GTGCGCAGACAGTGGAGCTCAGG - Intronic
1141734809 16:85845219-85845241 GAGTGCTGACAGAGGATTTGGGG + Intergenic
1142505162 17:358535-358557 CCGTGCGGACAGAGGAGCTGGGG + Intronic
1142863551 17:2777393-2777415 TATTGCAGGAAGAGGAGCTAGGG + Intronic
1142991965 17:3737383-3737405 GAGGGGGGACAGAGGAGTTAAGG + Intronic
1143091087 17:4449501-4449523 GTGTGAAGACAGTGGAGCTCAGG + Intronic
1143252365 17:5533033-5533055 CAGTGCAGCCATAGGGGCTAGGG - Intronic
1144099121 17:11928634-11928656 AAGACCAGACAGAGGAGCTTGGG + Intronic
1144788844 17:17846471-17846493 GAAGGCAGGCAGAGCAGCTAGGG - Intronic
1149013880 17:51886027-51886049 GAGTGCAGAGAGATTAGCAAAGG + Intronic
1151092587 17:71459875-71459897 GAGTACAGACACAGGAATTAAGG + Intergenic
1152645545 17:81466982-81467004 GAGTGCGGAGAGAGGTGCTCAGG + Intergenic
1154251559 18:12749255-12749277 GAGTGCAGAAACGGGAGCAAGGG - Intergenic
1154395795 18:13987415-13987437 GAGCTTAGACATAGGAGCTATGG + Intergenic
1155074675 18:22343986-22344008 GAGTGGAGACAGTGGTGCTAAGG - Intergenic
1155256594 18:24003193-24003215 GATTCCAGGCAGAGGAGCAATGG - Intronic
1155544274 18:26899476-26899498 GAGAGCAGACAATGGACCTAAGG - Intergenic
1156129860 18:33958352-33958374 GAGTGTAGACCGAGGAGCTGAGG - Exonic
1156498457 18:37541467-37541489 GGGGGCAGCCAGAGGAGCAATGG - Intronic
1156541101 18:37911370-37911392 GAAGGCAGGCAGAGGAGCAATGG + Intergenic
1157228453 18:45890246-45890268 GAGAGCACACAGAAGGGCTACGG - Intronic
1157700022 18:49756382-49756404 AAGTGCAGACAGGCGAACTAAGG + Intergenic
1159087366 18:63809261-63809283 GAGTGAGGGCAGATGAGCTATGG + Intergenic
1159138919 18:64369375-64369397 GAGTGCAGACAGATAAGAGAAGG + Intergenic
1161045721 19:2133342-2133364 AAGTGCTGACACAGGAGCTGGGG - Intronic
1161178394 19:2862562-2862584 GGCTGCAGACACAGGAACTAGGG - Intergenic
1163057505 19:14731570-14731592 GACAGCAGACAAAGGAGCTAGGG - Intronic
1163375661 19:16928706-16928728 GGGAGCAGAGAGAGGAGGTAGGG - Intronic
1165082012 19:33312526-33312548 AAGTGCAGACAATGAAGCTACGG + Intergenic
1165572770 19:36789627-36789649 GGGTGGAGACAGAGAAACTAAGG - Intergenic
1165683719 19:37799780-37799802 GGGTGGAGACAGAGAAACTAAGG - Intronic
1166746185 19:45142924-45142946 GAGTGCAGTGGGAGGAGCTCTGG + Intronic
1167521600 19:49959003-49959025 GAAAGGAGACAGAGGAGCCAGGG - Intronic
1167523781 19:49971719-49971741 GAAAGGAGACAGAGGAGCCAGGG + Intergenic
925973888 2:9127286-9127308 GAGTGCAGCTAGATCAGCTAGGG - Intergenic
926566147 2:14476615-14476637 GAGAGCAGACAGAGGAAGAAAGG - Intergenic
926571683 2:14536217-14536239 GAGAACAGACAGTGGAGCTTTGG + Intergenic
927250173 2:20989738-20989760 GGGGGCACACAGAGGAGCTGAGG - Intergenic
927505465 2:23610527-23610549 AAATGCAGACAGAGGGCCTATGG - Intronic
927514759 2:23665709-23665731 GAGGGCAGACAGAAGAGAGAGGG + Intronic
928871232 2:35982942-35982964 GAGGGAAGACAGAGGAGTTGAGG + Intergenic
934681239 2:96285457-96285479 GAGTGCAGACAGAGGAGCTAAGG + Intronic
935237090 2:101148637-101148659 GAGTTTAGACAGAGGAGATCTGG - Intronic
937220619 2:120341308-120341330 TGGGGCAGACAGAGGAGCTGAGG - Intergenic
937651664 2:124326131-124326153 AAGTGGAGACAGAGGAGGGAAGG + Intronic
937857367 2:126682330-126682352 GACTGCAGTCTCAGGAGCTATGG + Intronic
937872329 2:126794993-126795015 GAGTTCAGACAGAGGATGAATGG + Intergenic
941836084 2:170022294-170022316 GAGTGGAGACATAGGAACTCCGG + Intronic
942382209 2:175403833-175403855 GAGAGGAGAAAGAAGAGCTATGG - Intergenic
944019924 2:195089871-195089893 GAGTGCGGAGAGAGAAGTTATGG + Intergenic
944962244 2:204888342-204888364 GAGAGCAAACAGAGGAGAAAGGG + Intronic
945061034 2:205909123-205909145 CAGTGCAGACAGAGGTCCTGTGG - Intergenic
945590920 2:211730467-211730489 GAGAGAAGACAGAGGAGATAGGG - Intronic
945780145 2:214160450-214160472 GATTACAGAGAAAGGAGCTAAGG - Intronic
948255550 2:236566027-236566049 GAGTGGAGACAGTGCAGTTATGG - Intergenic
1170259952 20:14393480-14393502 GATTCCAGGCAGAGGAACTAAGG - Intronic
1170305902 20:14937284-14937306 GTGTGCAGGCAGAGGAGGAAAGG + Intronic
1170497953 20:16944991-16945013 GAGAGCACACAGAAGTGCTAAGG - Intergenic
1171512025 20:25693852-25693874 GAGTGGAGGAAGAGGAGCTGGGG + Intronic
1171527529 20:25826897-25826919 GGGTGGAGACAGAGAAACTAAGG - Intronic
1171549297 20:26028987-26029009 GGGTGGAGACAGAGAAACTAAGG + Intergenic
1172285400 20:33736921-33736943 GAGTCCAGACAAAGGAACAAAGG + Intronic
1172450523 20:35019419-35019441 GAGGGCAGAAAGAGGAGACAGGG + Intronic
1172809716 20:37638604-37638626 GGGTGCAGTGAGAGGAGCTCTGG + Intergenic
1172839896 20:37896520-37896542 TTGTGCAGACAGAGGAACTGAGG - Intergenic
1173645740 20:44632112-44632134 GAGTTTAGACAGAGCAGCCAGGG + Intronic
1174698874 20:52587773-52587795 GAGTTAATTCAGAGGAGCTATGG - Intergenic
1175002870 20:55648666-55648688 GAAGGCAGAGAGTGGAGCTAGGG + Intergenic
1175100243 20:56574317-56574339 GAGGACAGAAAGAGGAGCAAAGG - Intergenic
1176626162 21:9093429-9093451 AAGTGAAGACAGAGGAGCAGAGG + Intergenic
1178723272 21:35028948-35028970 CACTGCAGACAGATGAGCTAGGG - Intronic
1179005129 21:37507307-37507329 GAGTGAAGACACCGGAGCTGAGG - Intronic
1179161284 21:38901341-38901363 GAGTGCAGAGAGAGGAAGGAGGG - Intergenic
1179163985 21:38920823-38920845 GGCTGCAAACAGATGAGCTAGGG + Intergenic
1181562627 22:23714700-23714722 CACTGCAGACATAGGAGATATGG + Intergenic
1181909447 22:26226924-26226946 GAGAGCAGAAAGAGGAGCTGGGG + Intronic
1183301872 22:37062656-37062678 GGGTGCAGACAGAGGAGGCCGGG - Exonic
1184043530 22:41958270-41958292 GAGTGGAGGCAGGGGAGCTGGGG - Intergenic
1185039555 22:48497360-48497382 GAGTGCAGAAACAGGGGCAAGGG - Intronic
1185395057 22:50582572-50582594 GAGTGCAGCCCGAGGAGCTGAGG - Exonic
949710286 3:6863171-6863193 GAGTGAAGACAGAGGAGGAAAGG - Intronic
950713101 3:14827893-14827915 CATTGCAGACAGAGCAGTTAAGG + Intronic
952904881 3:38133167-38133189 TAGGGCAGAAAGAGGAGGTAGGG + Intronic
952970676 3:38648899-38648921 GAGATCAGACAGAGGAGATGCGG + Intronic
953732669 3:45463731-45463753 GAATACAGACAGAGCAGCTGAGG + Intronic
953962192 3:47274684-47274706 AGGTGAAGACAGAGGAACTAAGG - Intronic
954155719 3:48683939-48683961 GAGTGCAGGGAGAGGAGACAGGG + Intronic
954219766 3:49145844-49145866 GAGTGTAGGCAGAGGAGCCCAGG - Intergenic
954878010 3:53815847-53815869 GAGTGCAGAAACAGGAGTTCAGG - Exonic
957016474 3:75069887-75069909 GAGGGCAGCCAGAGGAGCAGGGG - Intergenic
957161565 3:76616980-76617002 GACTGGAGACTGAGTAGCTAAGG - Intronic
957300264 3:78382855-78382877 GAGTACAAAAAGAGAAGCTAGGG - Intergenic
958045276 3:88277199-88277221 GACTGCAGAGAGAGGATCTATGG - Intergenic
959261437 3:104086921-104086943 TACTTCAGAAAGAGGAGCTATGG + Intergenic
959275303 3:104270062-104270084 AAGGGCAGCCAGAGGAGCAACGG - Intergenic
959899317 3:111642050-111642072 GAGTGCAAACAGACAATCTAAGG + Intronic
961367772 3:126412219-126412241 GAGTGCAGGAAGAGAAGCCAAGG - Intronic
961382923 3:126507818-126507840 GGGGGCAGACAGAGGGGCTGAGG + Intronic
961558559 3:127713307-127713329 GTGTGCAGCCAGAGGAGACATGG + Intronic
962684055 3:137829372-137829394 GAGTGCAAACTGATGAGCTCTGG + Intergenic
963254555 3:143131778-143131800 GCTTGCAGAAAGAGGAGCCAGGG + Intergenic
967388308 3:188930882-188930904 GAGCTCAGACAGAGGAGATCTGG + Intergenic
968592462 4:1465883-1465905 GAGTGCAGACAGGGCAGGGAGGG - Intergenic
968935044 4:3605434-3605456 GACTGCAGACATCGGAGCTGGGG - Intergenic
969511087 4:7618370-7618392 GAGGGCAGACAGAGGGGCTGGGG - Intronic
970441771 4:16086163-16086185 GACACCAGACAGGGGAGCTAAGG + Intergenic
970544669 4:17115317-17115339 GAGGGGATGCAGAGGAGCTATGG - Intergenic
970658702 4:18260623-18260645 GAGGGTGGCCAGAGGAGCTAGGG - Intergenic
970752264 4:19378037-19378059 GGTTGAAGACAGAGGAGCTAGGG - Intergenic
971377557 4:26067434-26067456 GAATGCAGACAGAGGTGCAAGGG + Intergenic
971778527 4:30999594-30999616 GAGTGCAGAAAAATGAGCAAGGG + Intronic
972907066 4:43763437-43763459 GACAGCAGGCAGAGGAGCTGTGG - Intergenic
977150669 4:93507664-93507686 CAGTGCAGACAGAGAAGATAAGG - Intronic
977380640 4:96269402-96269424 GAGTTCAGGCAGAGGATATAGGG - Intergenic
977733146 4:100379551-100379573 GAGGGCAGCCAGAGGAGTGAGGG + Intergenic
977746717 4:100558297-100558319 GAGGGCAGCCAGAGGAGCAGGGG + Intronic
978160519 4:105541677-105541699 GAGTGCAGAGAAAGGAGGCAGGG - Intergenic
981438365 4:144752938-144752960 AAATGCAGGCAGAGGAACTAGGG + Intergenic
982256888 4:153459494-153459516 GAAAGCAGACTGAGGAGGTAGGG + Intergenic
982868885 4:160550615-160550637 GAGTCCAGGCAGAGGAGGCACGG + Intergenic
984852979 4:184169546-184169568 GACGGCAGAGAGAGGAGCCAGGG - Intronic
990943782 5:61229599-61229621 GAGAGCAGACTGAGCAGCCACGG - Intergenic
991721736 5:69499937-69499959 GAGTGCACTTAGAGGAGATAAGG + Intronic
991900046 5:71451707-71451729 AAGTGAAGACTGAGGAGCTCTGG + Intergenic
992013159 5:72550830-72550852 GAGTGAAGACAGGGGACTTATGG + Intergenic
993617196 5:90127863-90127885 GGGTGCAGAAAGGGGAGATATGG + Intergenic
993916976 5:93755785-93755807 GAGGGCAGCCAGAGGAGCAGGGG + Intronic
994379261 5:99051960-99051982 AACTGCAGACAGAGGACCTAAGG + Intergenic
994999106 5:107104625-107104647 GAGTGCAGAAACTGGAGCGAAGG - Intergenic
995256724 5:110055314-110055336 GAGTGCAGGCAGAGAAACAAGGG + Intergenic
996063801 5:119059904-119059926 GAGTAAACACAGAGGAGATAAGG - Intronic
997600338 5:135134509-135134531 GAGAGCTGACAGAGGAGAGATGG - Intronic
997657823 5:135568450-135568472 GAGTGCAGACAGAGCATGTGGGG + Intergenic
998190675 5:140021641-140021663 GAGTTCAGACAGAAGGGCCATGG + Intronic
998393428 5:141802834-141802856 GAGAGAAGACAGAGAAGCTGTGG - Intergenic
998757642 5:145398431-145398453 GAGTGAAAACAGGGGAGGTAGGG - Intergenic
999818430 5:155200581-155200603 GAGGGCAGCCAGAGGAGTCAGGG + Intergenic
1000257261 5:159551769-159551791 GAGTACAGACAAAGGGGCTAAGG - Intergenic
1002193935 5:177492274-177492296 GAGGGCAGAAACCGGAGCTAAGG - Intronic
1002210173 5:177594114-177594136 GAGGACAGACAAAGGAGATAAGG - Intronic
1003130810 6:3393902-3393924 GAGTGCAGGGAGAGGAGGGAAGG - Intronic
1006281589 6:33058631-33058653 GAGTGTAGAGAGATGAGCAAAGG - Intergenic
1006575341 6:35041163-35041185 GAAGGCAGTCAGAGGAGCCAAGG - Intronic
1007605929 6:43118052-43118074 GTGGGCAGTCAGAGGAACTAGGG + Intronic
1007748205 6:44056214-44056236 GAGAGCAAACAGAGAAGCTCGGG + Intergenic
1008471578 6:51890960-51890982 CAGTGCAGACAGTAGGGCTATGG + Intronic
1009338534 6:62524982-62525004 TTGTGCACACAGAGGAGCTGTGG + Intergenic
1009474650 6:64075291-64075313 GATGGCAGACAGAGAAGCTCTGG + Intronic
1010082483 6:71880487-71880509 GAGTGCAGAAATAGGAACTCTGG - Intergenic
1011225428 6:85099945-85099967 GAGTGCAAACAGACAATCTAAGG + Intergenic
1011623091 6:89260903-89260925 GAGAGCAGACAGAGGTGAGAAGG - Intronic
1011833965 6:91407098-91407120 GAGCGCAAACAGACGATCTAAGG + Intergenic
1012793668 6:103733949-103733971 GAGGGCAGCCAGAGGAGCAGGGG + Intergenic
1015229159 6:130894047-130894069 GACTGCAGACAAAGGAGATGAGG + Intronic
1016642221 6:146362063-146362085 GAGAGCAGAGAGAGGAGAGAGGG - Intronic
1017346408 6:153387226-153387248 GAGTGGAGAGAGAGGAGGCAAGG + Intergenic
1018204496 6:161424569-161424591 GATTGCAGACACAGGAACTCAGG + Intronic
1018707740 6:166475348-166475370 GAGAGGAGACAGAGCAGCCAGGG - Intronic
1018810839 6:167296720-167296742 GGGTAGAGACAGAGGAGCCAGGG - Intronic
1018867712 6:167758828-167758850 GCGTGCAGGCAGAGGAGAGAGGG + Intergenic
1019263492 7:96784-96806 GAGTGCAAACAGAGTAGATGCGG + Intergenic
1019268307 7:131504-131526 AAATGCACACAGAGGAGCTCAGG - Intergenic
1019333491 7:471723-471745 CAGGGGAGACAGAGGAGCTCTGG + Intergenic
1021729835 7:23585529-23585551 GAGTGGAGACAATGGTGCTATGG + Intergenic
1022143003 7:27509418-27509440 TGGAGCAGACACAGGAGCTAGGG + Intergenic
1022930317 7:35105084-35105106 TGGAGCAGGCAGAGGAGCTAGGG + Intergenic
1024333978 7:48185115-48185137 GAGTGGAGATAGAGGAGGCAGGG - Intronic
1024745438 7:52400369-52400391 GAGGGCGGCCAGAGGAGCTGGGG - Intergenic
1025032917 7:55572150-55572172 GAGCGCAGACGGTGGAGCGACGG - Intronic
1025164210 7:56696610-56696632 GAGTGCATGCATAGGTGCTAAGG - Intergenic
1025227480 7:57177887-57177909 CACTGCAGACAAAGGAGATATGG + Intergenic
1025230598 7:57201336-57201358 CACTGCAGACACAGGAGATATGG + Intergenic
1025298117 7:57792972-57792994 GGGTGGAGACAGAGAAACTAAGG + Intergenic
1025706080 7:63865447-63865469 GAGTGCATGCATAGGTGCTAAGG + Intergenic
1025928905 7:65979910-65979932 CACTGCAGACACAGGAGATACGG + Exonic
1026900170 7:74032667-74032689 GAGTGGGGACAGAGGAGATCTGG + Intronic
1027575263 7:79922893-79922915 GAGAGAAGACAGAAGAGCTGAGG + Intergenic
1028183034 7:87748066-87748088 GAGGGCAGCCAGAGGAGCAGGGG - Intronic
1028294588 7:89112762-89112784 GAGTGAAGAGAGAGGAATTAGGG + Intronic
1028343968 7:89757751-89757773 GGGTGGAGTCAGAGGAGCAAAGG - Intergenic
1033116804 7:138632646-138632668 GAGGCCAGACAGGGGAGCCAGGG + Intronic
1034035225 7:147812643-147812665 GAGAGCAGAGAGAGGACCTGAGG - Intronic
1034218902 7:149429507-149429529 GAGTGGAGACGGAGGTGCTGTGG - Intergenic
1035243290 7:157546191-157546213 GAGTGCAGAAAACGGAGCTTCGG + Intronic
1035980255 8:4362339-4362361 GGGGGCAGACAGATGAGCTTGGG - Intronic
1038367286 8:26948831-26948853 GAGGGCAGCCAGAGGAGCAGGGG - Intergenic
1039282755 8:36004950-36004972 GAGAGCAGACAGGGGAGCTGAGG - Intergenic
1041554827 8:59141819-59141841 GAGTGAACACAGAGTGGCTACGG + Intergenic
1043616611 8:82132851-82132873 GAGTGCAAATAGACGATCTAAGG + Intergenic
1044515443 8:93132912-93132934 GAGTGCAGACAGAAGCGCAATGG + Intergenic
1045429744 8:102102688-102102710 GTGTGCAGAAGGAGGAGCTCAGG - Intronic
1045586544 8:103544306-103544328 GAGTTCAGGCAGAAGAGGTATGG - Intronic
1048445608 8:134490588-134490610 CAGAGCTGACAGAGGGGCTACGG + Intronic
1049046562 8:140156759-140156781 GAGGGCTGTCAGAGGAGCTGTGG + Intronic
1049632541 8:143666431-143666453 GTGTGCACACAGAGGAGGGAGGG - Intergenic
1049632560 8:143666529-143666551 GTGTGCACACAGAGGAGGGAGGG - Intergenic
1049632582 8:143666627-143666649 GTGTGCACACAGAGGAGGGAGGG - Intergenic
1049632614 8:143666773-143666795 GTGTGCACACAGAGGAGGGAGGG - Intergenic
1050485743 9:6132959-6132981 TGGTGCAGGCAGAGGAGCAAGGG - Intergenic
1050992342 9:12170204-12170226 TCTAGCAGACAGAGGAGCTAAGG - Intergenic
1052044583 9:23779307-23779329 GTGGGCAGACAGAGGAACAAAGG + Intronic
1052788717 9:32854151-32854173 AAGAGCAGAGAGAGGAGCCATGG - Intergenic
1053750669 9:41251312-41251334 GACAGCAGCCAGAGCAGCTAAGG + Intergenic
1054455131 9:65426544-65426566 GACTGCAGACATCGGAGCTGGGG + Intergenic
1054466066 9:65495200-65495222 GGGTGGAGACAGAGAAACTAAGG + Intergenic
1054750907 9:68905241-68905263 GAGTGCAGAGAGGAAAGCTATGG + Intronic
1056926317 9:90837737-90837759 GAGGGCAGCCTCAGGAGCTATGG + Intronic
1057817221 9:98304512-98304534 GAGTGCAGGCAGAGAAGTCACGG + Intronic
1058156746 9:101524559-101524581 GAGAGTAGACAGAGGAGCAGGGG - Intronic
1058419357 9:104819772-104819794 GAGTGAAGGCAGAGGACCTAGGG + Intronic
1059107047 9:111520967-111520989 GAGTGAAGACTGAGAAACTAGGG - Intergenic
1059552109 9:115239586-115239608 GAGTGAGGAGAGAGGAGCTGAGG + Intronic
1060655181 9:125367451-125367473 GAGTGCAGAGGCAGGATCTAGGG + Intergenic
1060852033 9:126886187-126886209 GAGTGGAGACAGAAGAGCCTGGG - Intergenic
1061584937 9:131559454-131559476 CATTGCAGACAGAGGAGGAAGGG + Intergenic
1061764298 9:132871690-132871712 CAGTGCAGAGAAAGGAGCAAGGG + Intronic
1061859545 9:133460800-133460822 GAGAGCGGACAGAGGACCCAGGG - Intronic
1062246143 9:135567414-135567436 GACTGGAGACAGAGTAGGTAAGG + Intergenic
1062483906 9:136764832-136764854 GAGTGTGGACAGAGGGGCTTGGG - Intronic
1203371394 Un_KI270442v1:308928-308950 GACAGCAGCCAGAGAAGCTAAGG - Intergenic
1185813320 X:3130640-3130662 GAGAGGACACAGAGAAGCTAAGG - Intergenic
1186077686 X:5898327-5898349 GAGTTCAGACAAAGGAACGAAGG - Intronic
1188473748 X:30568428-30568450 CATTGCAGACAGAGGAGAGAAGG + Intronic
1190114536 X:47617980-47618002 GAGTGCAGAAAGTTGATCTATGG + Intronic
1192995220 X:76505871-76505893 GAGACCGGACAGAGGAGCCAGGG - Intergenic
1195066484 X:101242577-101242599 GAGTGGAGAATGTGGAGCTAGGG + Intronic
1195732856 X:107982823-107982845 GTGTGGGGAAAGAGGAGCTAAGG - Intergenic
1196224587 X:113150847-113150869 GAGTGCCGAAAGAGGGGATATGG + Intergenic
1197132323 X:123019722-123019744 GAGGGCAGCCAGAGGAGCAGGGG + Intergenic
1199989618 X:152978901-152978923 GAGTGCAGATAGAAAAGCGAAGG - Intergenic
1200097319 X:153670305-153670327 GAGAGCAGAGGGAGGAGCCAGGG - Intronic
1201268277 Y:12229896-12229918 GAGAGGACACAGAGAAGCTAAGG + Intergenic
1202254537 Y:22907315-22907337 GAGTCCAGGCAGAGGAGGCAAGG - Intergenic
1202407528 Y:24541064-24541086 GAGTCCAGGCAGAGGAGGCAAGG - Intergenic
1202463254 Y:25129017-25129039 GAGTCCAGGCAGAGGAGGCAAGG + Intergenic