ID: 934683648

View in Genome Browser
Species Human (GRCh38)
Location 2:96305111-96305133
Sequence TCACTACTTTTCACAGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 151}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934683648_934683657 4 Left 934683648 2:96305111-96305133 CCCACACCTGTGAAAAGTAGTGA 0: 1
1: 0
2: 2
3: 14
4: 151
Right 934683657 2:96305138-96305160 GTTGGGAGTGACGTGTGGAAGGG 0: 1
1: 0
2: 0
3: 16
4: 221
934683648_934683658 5 Left 934683648 2:96305111-96305133 CCCACACCTGTGAAAAGTAGTGA 0: 1
1: 0
2: 2
3: 14
4: 151
Right 934683658 2:96305139-96305161 TTGGGAGTGACGTGTGGAAGGGG 0: 1
1: 0
2: 0
3: 20
4: 218
934683648_934683660 9 Left 934683648 2:96305111-96305133 CCCACACCTGTGAAAAGTAGTGA 0: 1
1: 0
2: 2
3: 14
4: 151
Right 934683660 2:96305143-96305165 GAGTGACGTGTGGAAGGGGGAGG 0: 1
1: 0
2: 4
3: 30
4: 346
934683648_934683655 -1 Left 934683648 2:96305111-96305133 CCCACACCTGTGAAAAGTAGTGA 0: 1
1: 0
2: 2
3: 14
4: 151
Right 934683655 2:96305133-96305155 AGTGGGTTGGGAGTGACGTGTGG 0: 1
1: 0
2: 3
3: 27
4: 279
934683648_934683659 6 Left 934683648 2:96305111-96305133 CCCACACCTGTGAAAAGTAGTGA 0: 1
1: 0
2: 2
3: 14
4: 151
Right 934683659 2:96305140-96305162 TGGGAGTGACGTGTGGAAGGGGG 0: 1
1: 2
2: 6
3: 27
4: 375
934683648_934683656 3 Left 934683648 2:96305111-96305133 CCCACACCTGTGAAAAGTAGTGA 0: 1
1: 0
2: 2
3: 14
4: 151
Right 934683656 2:96305137-96305159 GGTTGGGAGTGACGTGTGGAAGG 0: 1
1: 0
2: 1
3: 28
4: 283
934683648_934683662 24 Left 934683648 2:96305111-96305133 CCCACACCTGTGAAAAGTAGTGA 0: 1
1: 0
2: 2
3: 14
4: 151
Right 934683662 2:96305158-96305180 GGGGGAGGGCTTAGCGTTGAAGG 0: 1
1: 0
2: 1
3: 15
4: 97
934683648_934683661 10 Left 934683648 2:96305111-96305133 CCCACACCTGTGAAAAGTAGTGA 0: 1
1: 0
2: 2
3: 14
4: 151
Right 934683661 2:96305144-96305166 AGTGACGTGTGGAAGGGGGAGGG 0: 1
1: 0
2: 1
3: 38
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934683648 Original CRISPR TCACTACTTTTCACAGGTGT GGG (reversed) Intronic
900213759 1:1470055-1470077 TCACTAGTTCTTACAGGTTTTGG - Exonic
904371715 1:30051909-30051931 TACCCACTTTCCACAGGTGTGGG - Intergenic
907693550 1:56696836-56696858 TTGCTACTATACACAGGTGTGGG - Intronic
911809419 1:102255338-102255360 TCACTACATTCCACAAATGTTGG - Intergenic
912598031 1:110899108-110899130 CCAACTCTTTTCACAGGTGTTGG + Exonic
913284907 1:117217358-117217380 TCACCACATTTCACAGGTTTTGG + Intergenic
914375690 1:147071855-147071877 TCACTACTTCTCAGGGGAGTAGG + Intergenic
916422324 1:164648586-164648608 TCTCTACTATTTACAGGTTTTGG - Intronic
920396041 1:205646893-205646915 TCACCAATTTTCAAAGGTGGAGG - Intergenic
920654076 1:207862130-207862152 TCTGTCCTTTTCACAGGTGTAGG + Intergenic
921818815 1:219593671-219593693 CCCCTTCTTTTCACAGCTGTTGG - Intergenic
923446254 1:234074110-234074132 TACCTTCTTTTCACAGGTGTCGG + Intronic
924612670 1:245586993-245587015 TCACAACTTCTCTCAGGTGGAGG + Intronic
924850374 1:247823122-247823144 CCACTACTTTTACCAGGAGTTGG + Intergenic
1062773719 10:126802-126824 TAGCTTATTTTCACAGGTGTGGG + Intergenic
1063071661 10:2672286-2672308 TGGCTACTTTACACAGGAGTGGG - Intergenic
1065849223 10:29772844-29772866 TCCCCACTTTTCCCATGTGTTGG + Intergenic
1074103440 10:110371862-110371884 TCATTAGTTCTCACAGGTTTGGG + Intergenic
1076454636 10:130581426-130581448 TCATTACTGTTGACAGCTGTGGG - Intergenic
1078610844 11:12818083-12818105 TCATTACTTTTCATATATGTGGG + Intronic
1079334949 11:19563198-19563220 TCACTTCTTTTCCCTGGTCTTGG - Intronic
1081530580 11:43956235-43956257 TCAGTGATTTGCACAGGTGTGGG + Intergenic
1086191828 11:84088734-84088756 TCAATACTTTTCACTTTTGTTGG + Intronic
1086232691 11:84589474-84589496 TCACAACTTTTCACAGTACTAGG + Intronic
1087737151 11:101847240-101847262 TCAGTTCTTTTTAAAGGTGTAGG - Intronic
1091041965 11:132289609-132289631 TCACCACTTTTCCCTGGAGTTGG - Intronic
1091048256 11:132344752-132344774 TTACTACTTTTTTCAGGTATGGG + Intergenic
1091285377 11:134405764-134405786 TCCCTTCTTTTCACAGATGAGGG - Intronic
1094617331 12:32047519-32047541 TCACTGCTTTCCAGAGGTGCAGG + Intergenic
1096009606 12:48201848-48201870 TACCTACTTTTCACAGGAATTGG + Intergenic
1097466128 12:59927338-59927360 ACACTACTTTTCCCAAGTTTTGG - Intergenic
1097478959 12:60097206-60097228 AAACTAATTTTCACAGGTGATGG - Intergenic
1097494666 12:60315705-60315727 TAACTGATCTTCACAGGTGTAGG - Intergenic
1099520529 12:83655021-83655043 TCACTACTATATACAGGTCTAGG - Intergenic
1099684482 12:85867099-85867121 TCACTTCTTTTCTCAGGGGAAGG - Intergenic
1102009329 12:109608292-109608314 TCACTCCGTTTCACAGATCTTGG + Intergenic
1105635792 13:22214135-22214157 TCCCTAGTTGTCACAGCTGTAGG + Intergenic
1105763464 13:23534461-23534483 TCCCTTCTTTTCACAGGTGTTGG - Intergenic
1108418079 13:50221281-50221303 TCACTATGTTTCACACATGTTGG - Intronic
1111809959 13:93088035-93088057 TAAAGACTTTACACAGGTGTGGG + Intergenic
1111812879 13:93113848-93113870 TCACTACTTTTCAAACGTTGTGG - Intergenic
1111975635 13:94964182-94964204 TCACTATTTTTAAAAGGTGATGG + Intergenic
1115423409 14:33224410-33224432 ACATTAGTTTTCACAGGTGGAGG - Intronic
1115468730 14:33745656-33745678 TTACTACTTTTCATAGGTACAGG - Intronic
1116530114 14:45960863-45960885 TAATTACTTTACACAGTTGTAGG - Intergenic
1117003980 14:51399788-51399810 TCACTACTTTTGACAAGAGCTGG - Intergenic
1119388498 14:74274315-74274337 CCACTACTTTTAACATCTGTTGG + Intergenic
1121312030 14:92940535-92940557 TCACTCCTTTTCACACCTGCTGG - Exonic
1124590386 15:31048421-31048443 TCACAACTTTTGAAATGTGTTGG - Intronic
1125267948 15:37905249-37905271 TCACTAGTTTGCACATGTGCAGG - Intergenic
1126133675 15:45369498-45369520 CCAGTACTTTTCATATGTGTTGG + Exonic
1129944607 15:79527887-79527909 TCACTTCTTTTCACATGTTGTGG + Intergenic
1131823093 15:96292716-96292738 TCAATGCTTTTCACAAGTGAAGG - Intergenic
1134081830 16:11330114-11330136 TGACAACTTGTCACAGGTGGTGG - Intronic
1141117486 16:81322747-81322769 TTACTATTATTCAGAGGTGTAGG - Intronic
1141827148 16:86488574-86488596 TCAATGCTTTTCACTGCTGTAGG + Intergenic
1143466768 17:7142335-7142357 TCACTAGCTCTTACAGGTGTTGG + Intergenic
1148250662 17:46076908-46076930 TCTCTAATTCTCACAGGTTTAGG + Intronic
1148763848 17:50026217-50026239 TCCCTCCTTTTCACAGGTCCGGG - Intergenic
1149277562 17:55060782-55060804 TAACAACTTTTCACAGGCATGGG + Intronic
1154202962 18:12311962-12311984 ACACTGCTTTTCACAGGTATTGG - Intronic
1157650742 18:49327858-49327880 TCACTACAGTCCACAGATGTTGG + Intronic
1158250185 18:55479358-55479380 CCACTAGTTTTCAGAGGTATTGG - Intronic
1160199546 18:76784904-76784926 TCATTACTTCTCCCAGGGGTAGG - Intergenic
1161929911 19:7332255-7332277 TCCCTTCCTTTCATAGGTGTTGG - Intergenic
1165214575 19:34261320-34261342 TGAATACTTATCACAGGTGCCGG - Intronic
1165221431 19:34319891-34319913 TGTCTTGTTTTCACAGGTGTTGG + Exonic
1166235922 19:41456307-41456329 TCTTTACTTTCCACAGGTGAGGG + Intergenic
925944886 2:8851654-8851676 TTACTCCTTTTCCCAGTTGTGGG + Intergenic
926415860 2:12649368-12649390 TCCCTTCTTTTCACAGGTGCTGG - Intergenic
933393902 2:81707542-81707564 TCAATACTTTTCTCTGGAGTTGG + Intergenic
934683648 2:96305111-96305133 TCACTACTTTTCACAGGTGTGGG - Intronic
934754839 2:96817594-96817616 TCACTGCTCTCCACAGGGGTGGG - Intronic
935332419 2:101986715-101986737 TCACTACTTTTCAGAAGTGTGGG + Intergenic
936550331 2:113432887-113432909 TCACTACTTGTTACAAGAGTAGG + Intergenic
936867860 2:117096898-117096920 TCATTAATTTTCACAGCAGTTGG + Intergenic
938926599 2:136048829-136048851 TCCCTTCTTTTGACAGGTTTTGG - Intergenic
940859249 2:158755172-158755194 TAAATATTTTTCACATGTGTTGG - Intergenic
942887598 2:180946205-180946227 TCACTTCTGTACACTGGTGTTGG + Intergenic
945641682 2:212439783-212439805 TAAATACTTTCCTCAGGTGTTGG - Intronic
948723335 2:239917272-239917294 TCAAGACTTTTCATGGGTGTGGG - Intronic
1170362952 20:15567445-15567467 TCTCTATTATTCCCAGGTGTTGG - Intronic
1171131383 20:22656847-22656869 CCACCTCTCTTCACAGGTGTAGG - Intergenic
1173380012 20:42531741-42531763 TCACTACTTTGGATAGATGTTGG + Intronic
1173854911 20:46244040-46244062 GCCCTACTTGGCACAGGTGTGGG + Intronic
1175116098 20:56683589-56683611 GCCCTCCTTTCCACAGGTGTGGG + Intergenic
1175263049 20:57686705-57686727 TCACTCCATCTCACAGGTGAGGG - Intronic
1175765742 20:61591251-61591273 TCACTACTTTTCAAATGTCTGGG - Intronic
1181975108 22:26723289-26723311 TAACTCCTTTCCACAGGTCTGGG - Intergenic
950852186 3:16072664-16072686 TGAGTACTTTATACAGGTGTAGG + Intergenic
951048596 3:18068652-18068674 TCACTTCATTTCATAGCTGTAGG + Intronic
952124866 3:30288820-30288842 TGAATTCTTTTCACAGGTGTTGG + Intergenic
952436943 3:33280957-33280979 TCAAGACTTGTCACAGGTATTGG + Intronic
953682270 3:45048570-45048592 TCTCTCTTTTACACAGGTGTGGG + Intergenic
954332492 3:49898422-49898444 TCACAATTTTTCTCAGGTCTGGG - Intronic
958848984 3:99299933-99299955 TCTGTGCTTTTCACAGGTTTGGG - Intergenic
959195078 3:103169955-103169977 TCAGTACTATTCACAGGTTCAGG + Intergenic
962856357 3:139349377-139349399 TCTCAAGTTTTCAGAGGTGTAGG - Intronic
964686807 3:159404496-159404518 GAAGTACTTGTCACAGGTGTGGG + Intronic
965018738 3:163197811-163197833 TAAATACTTTTCAAAGATGTAGG - Intergenic
965787967 3:172356343-172356365 TCACTACTTAACAGAGTTGTTGG + Intronic
971534637 4:27733966-27733988 TCACTGCTTTCTACAAGTGTTGG + Intergenic
974060958 4:57035279-57035301 TCCCTTCTTTTCACAAGTGTTGG + Intronic
975721099 4:77249448-77249470 TCACTACACTTCTCAGGTCTTGG + Intronic
977166935 4:93711215-93711237 GCAGTACTTGGCACAGGTGTTGG - Intronic
977187826 4:93962416-93962438 TCACTTTTTTTTACAGGTGGGGG + Intergenic
982661408 4:158211268-158211290 TCTCTCCGTTTCAGAGGTGTAGG + Intronic
983051135 4:163048960-163048982 TCAGTACTATTCACAGTTATAGG + Intergenic
983256424 4:165405446-165405468 TCAATTATTTTCAGAGGTGTGGG + Intronic
983450752 4:167908068-167908090 TCACTACCTTTCACAGGTCAAGG - Intergenic
984520423 4:180795555-180795577 TCACCAACTTTCACAGGTGAAGG - Intergenic
984718295 4:182946174-182946196 TAGCTTATTTTCACAGGTGTGGG - Intergenic
985425135 4:189822598-189822620 TCACTACTTTTCTAGGCTGTGGG + Intergenic
986300132 5:6471914-6471936 TCACTTTTTGTCTCAGGTGTAGG + Intronic
986420615 5:7577544-7577566 TCACCACTTCTCCCAGCTGTTGG - Intronic
986433622 5:7705933-7705955 TCACTACAATTCACAAGTGGTGG + Intronic
986615930 5:9617492-9617514 TCAGTACTTTAGACAGATGTAGG - Intergenic
986843080 5:11720614-11720636 TCTATATTCTTCACAGGTGTGGG + Intronic
988384710 5:30546926-30546948 TTCCTTCTTTTCACAGGTATTGG - Intergenic
991231965 5:64344561-64344583 CCACTATTTTTCACAGGTGAAGG - Intronic
991319883 5:65360760-65360782 TCACTCTTTTTCTTAGGTGTCGG - Intronic
992645229 5:78805533-78805555 TCACTGCTTTCCACAGAGGTAGG + Intronic
994676587 5:102830385-102830407 TCACTACTTTATACAGGTCAGGG + Intronic
1000151380 5:158504749-158504771 TCTCCACTTTACACAGGTATTGG - Intergenic
1002286775 5:178167973-178167995 TAACTACTTTACACAGTGGTGGG + Intergenic
1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG + Intronic
1008985752 6:57541061-57541083 TCATTACTTTTCTCTGGTTTGGG - Intronic
1009173779 6:60433930-60433952 TCATTACTTTTCTCTGGTTTGGG - Intergenic
1009566866 6:65320987-65321009 CCCCTTCTTTTCACAGCTGTTGG + Intronic
1011492252 6:87904216-87904238 TCATTACTTTTCAGAGGTTGGGG + Intergenic
1016530451 6:145053497-145053519 CTACTCCTTTGCACAGGTGTTGG + Intergenic
1017567053 6:155698819-155698841 TAACTACTTTGCAAAGTTGTTGG - Intergenic
1020610656 7:10393024-10393046 TCATTACTTTTCATAGGCTTTGG - Intergenic
1022377822 7:29830980-29831002 TCACCACTTTTCACATGCCTGGG - Intronic
1023137529 7:37067342-37067364 TCACTACTTTTCAGGTCTGTTGG + Intronic
1023320614 7:38993905-38993927 TTAGTACCTTTCACAGCTGTGGG + Intronic
1024761786 7:52606638-52606660 TAATTATTTTTCACTGGTGTTGG + Intergenic
1028991044 7:97049290-97049312 TCTCTACATCTCACAGTTGTTGG + Intergenic
1029813363 7:103070813-103070835 TCACTAATTATCACAGGGGAGGG + Intronic
1032950143 7:136899506-136899528 TCACAACTTTGCACATCTGTTGG + Intronic
1033762359 7:144449441-144449463 TCACTCCTCTTCACAGGTCATGG - Intergenic
1034266094 7:149781399-149781421 TCACTACTTATGAGAGGAGTGGG - Intergenic
1034507467 7:151504911-151504933 TCCTTTCTTTTTACAGGTGTGGG + Intronic
1034678502 7:152910227-152910249 CCACCACTTTTCACAGGGGAAGG + Intergenic
1036591322 8:10171303-10171325 TCACTACTTTTTTCAGGACTAGG - Intronic
1042570656 8:70161027-70161049 TACCTACTTTTCAGAGGTGTTGG - Intronic
1043460814 8:80458362-80458384 ACACTACTGGTCACAGGGGTGGG - Intergenic
1043527141 8:81109744-81109766 TCACTACTGTTCAGTGGGGTAGG + Intronic
1047168886 8:122470133-122470155 TCAGTAATTGGCACAGGTGTGGG + Intergenic
1048266511 8:132992001-132992023 TCACTTCTCTCCACAGGTGCAGG + Intronic
1048761037 8:137795583-137795605 TCACTATGTTTCAAAGGTATGGG - Intergenic
1048856464 8:138690563-138690585 TCTGTACATTTCACTGGTGTTGG - Intronic
1049902607 9:183933-183955 TCACTACTTGTTACAAGAGTAGG - Intergenic
1052044943 9:23783129-23783151 TGGCTACCTTTCACAGGTATTGG - Intronic
1052618507 9:30874590-30874612 TCTCTCCTTTTCACAGGTTTTGG - Intergenic
1053060590 9:35028062-35028084 TAGCTTCTTTTCACAGGTGTGGG - Intergenic
1053745631 9:41194219-41194241 TCACTACTTGTTACAAGAGTAGG - Intronic
1054481640 9:65670995-65671017 TCACTACTTGTTACAAGAGTAGG + Intronic
1054682711 9:68237052-68237074 TCACTACTTGTTACAAGAGTAGG + Intronic
1057780424 9:98045423-98045445 TCAGTAATTGGCACAGGTGTGGG - Intergenic
1061314098 9:129783405-129783427 TCAATACCATTCACAGGTATTGG - Intergenic
1202781764 9_KI270718v1_random:5000-5022 TCACTACTTGTTACAAGAGTAGG - Intergenic
1186578616 X:10793156-10793178 TGACTACTTTCCACAGATGTGGG - Intronic
1186847908 X:13549774-13549796 TCGCTACTCTTCACAGTTTTAGG + Intergenic
1191013728 X:55788485-55788507 TCATTACTTCTTACAGGTTTAGG + Intergenic
1193870907 X:86796861-86796883 TCAGTACTCTTCACTGTTGTAGG - Intronic
1198984275 X:142431467-142431489 TCACTAGTTCTTACAGGTTTTGG - Intergenic
1202043007 Y:20705411-20705433 TCACTGCATTTCATAGGTTTTGG - Intergenic