ID: 934683739

View in Genome Browser
Species Human (GRCh38)
Location 2:96305561-96305583
Sequence AACGGGTTCCCTTCCGCTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 41}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934683728_934683739 26 Left 934683728 2:96305512-96305534 CCCGCCGCGCCGGAACGACGCAG 0: 1
1: 0
2: 0
3: 2
4: 26
Right 934683739 2:96305561-96305583 AACGGGTTCCCTTCCGCTTCCGG 0: 1
1: 0
2: 0
3: 2
4: 41
934683732_934683739 17 Left 934683732 2:96305521-96305543 CCGGAACGACGCAGGAAAGACGC 0: 1
1: 0
2: 0
3: 5
4: 52
Right 934683739 2:96305561-96305583 AACGGGTTCCCTTCCGCTTCCGG 0: 1
1: 0
2: 0
3: 2
4: 41
934683731_934683739 22 Left 934683731 2:96305516-96305538 CCGCGCCGGAACGACGCAGGAAA 0: 1
1: 0
2: 0
3: 2
4: 20
Right 934683739 2:96305561-96305583 AACGGGTTCCCTTCCGCTTCCGG 0: 1
1: 0
2: 0
3: 2
4: 41
934683729_934683739 25 Left 934683729 2:96305513-96305535 CCGCCGCGCCGGAACGACGCAGG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 934683739 2:96305561-96305583 AACGGGTTCCCTTCCGCTTCCGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934683739 Original CRISPR AACGGGTTCCCTTCCGCTTC CGG Intergenic
909270508 1:73617744-73617766 AGCAGGTTCCCTTCCGGTTCAGG + Intergenic
1067240955 10:44492904-44492926 AACTGGGTCACTTCCGCCTCTGG + Intergenic
1076279540 10:129234051-129234073 AATGGGTTCCCCTCTGCTTCTGG - Intergenic
1083922153 11:65786861-65786883 ACCGGTTTCCATTCCGCTGCGGG - Intergenic
1087532966 11:99407307-99407329 AGCGGGTTCCCTTCTGGCTCAGG + Intronic
1094775187 12:33718598-33718620 AAGGAGTTCCCTTCCTCTGCAGG - Intergenic
1100381188 12:94063312-94063334 AGCGGGTTCCCTTCTGGCTCAGG - Intergenic
1104892047 12:132144762-132144784 AACCCGTTCCCTTCCCCCTCGGG - Intronic
1104970973 12:132530562-132530584 ACTGGGTGCCCTTCTGCTTCTGG + Intronic
1111941437 13:94612342-94612364 AATGGATTCCCTTCGGCATCTGG - Exonic
1116720122 14:48485296-48485318 AACTGGATCCTTTCCACTTCAGG + Intergenic
1129698413 15:77753862-77753884 AAGGGGTTCCCTGCCTCTTTGGG - Intronic
1131174284 15:90200638-90200660 TAGGGGTTCCCTTCCCCTGCCGG + Intronic
1133782732 16:8952488-8952510 AAATGTTTCCCTGCCGCTTCCGG + Intronic
1141192203 16:81833033-81833055 GAGAGGTTGCCTTCCGCTTCTGG - Intronic
1144736664 17:17559443-17559465 AGCGGGTTCCCTTCCCCGACAGG - Intronic
1148901789 17:50884100-50884122 ACCAGGTTCCCTCCCACTTCAGG + Intergenic
1163615122 19:18322664-18322686 GAAGGGGTCCCTTACGCTTCGGG - Intronic
1165645372 19:37431435-37431457 AACAGGTTCCCTTCTGGTCCAGG - Intronic
934683739 2:96305561-96305583 AACGGGTTCCCTTCCGCTTCCGG + Intergenic
934749409 2:96783202-96783224 AAGGGGTTCCCTGCCACCTCTGG + Intronic
949235733 3:1806327-1806349 AGCAGGTTCTCTTCTGCTTCAGG + Intergenic
949625982 3:5867226-5867248 AACAAGTTTCCTTCTGCTTCTGG - Intergenic
972909562 4:43797681-43797703 ACTGGGTTCCCCTCTGCTTCAGG - Intergenic
981209990 4:142092137-142092159 AAGAGGTTCCTTTCCTCTTCAGG - Intronic
986102746 5:4629097-4629119 AACGGGCTGCCTTCCCCTCCTGG + Intergenic
993566223 5:89478984-89479006 AATGGCTTCCCATCTGCTTCAGG - Intergenic
1003117195 6:3290875-3290897 TCCTGGTTCCCCTCCGCTTCGGG - Intronic
1012553083 6:100482034-100482056 GCGGGGTTCCCTTCAGCTTCTGG + Intergenic
1019746474 7:2702963-2702985 AAAAGGTTCCCTTCCTCTCCTGG - Intronic
1021280019 7:18705963-18705985 AAAGGGTTCCTTTCCACTACAGG - Intronic
1028382616 7:90215363-90215385 AACAGGTGCCATTCAGCTTCAGG + Intronic
1030127588 7:106169162-106169184 AACAAGTTCCCTTCAGCTTTTGG + Intergenic
1036459090 8:8936172-8936194 AGCAGGCTCCCTTCCCCTTCGGG + Intergenic
1039510632 8:38089259-38089281 CACCGATTCCCTGCCGCTTCTGG + Intergenic
1042082574 8:65071334-65071356 AATGGGTTCCCTTCTGGTCCAGG + Intergenic
1056627940 9:88269471-88269493 GAAGGGTTACCTTCCACTTCTGG + Intergenic
1060627208 9:125124617-125124639 AACGGATACCCTTCCGAGTCTGG - Intronic
1195512616 X:105734767-105734789 AAAAGGTTCCCTTATGCTTCTGG - Intronic
1199005692 X:142693624-142693646 AACAGGTTCCCTTCTTCTCCAGG - Intergenic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic