ID: 934685899

View in Genome Browser
Species Human (GRCh38)
Location 2:96321521-96321543
Sequence TCTAGGGACCGGTAGCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934685894_934685899 4 Left 934685894 2:96321494-96321516 CCAGATCGGTCGAAGGCAGGTCT No data
Right 934685899 2:96321521-96321543 TCTAGGGACCGGTAGCTCAGAGG No data
934685890_934685899 30 Left 934685890 2:96321468-96321490 CCTGGGCTTGCAGCTGGGACTCA No data
Right 934685899 2:96321521-96321543 TCTAGGGACCGGTAGCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934685899 Original CRISPR TCTAGGGACCGGTAGCTCAG AGG Intergenic
No off target data available for this crispr