ID: 934685931

View in Genome Browser
Species Human (GRCh38)
Location 2:96321753-96321775
Sequence CCGCGATGCGCTGTTCCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934685931_934685935 -5 Left 934685931 2:96321753-96321775 CCAGCGGGAACAGCGCATCGCGG No data
Right 934685935 2:96321771-96321793 CGCGGACGCTGCAGGGAGTGTGG No data
934685931_934685936 7 Left 934685931 2:96321753-96321775 CCAGCGGGAACAGCGCATCGCGG No data
Right 934685936 2:96321783-96321805 AGGGAGTGTGGCCCCTCCGCAGG No data
934685931_934685939 19 Left 934685931 2:96321753-96321775 CCAGCGGGAACAGCGCATCGCGG No data
Right 934685939 2:96321795-96321817 CCCTCCGCAGGCGCGTGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934685931 Original CRISPR CCGCGATGCGCTGTTCCCGC TGG (reversed) Intergenic