ID: 934685935

View in Genome Browser
Species Human (GRCh38)
Location 2:96321771-96321793
Sequence CGCGGACGCTGCAGGGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934685930_934685935 2 Left 934685930 2:96321746-96321768 CCGAGCGCCAGCGGGAACAGCGC No data
Right 934685935 2:96321771-96321793 CGCGGACGCTGCAGGGAGTGTGG No data
934685925_934685935 17 Left 934685925 2:96321731-96321753 CCAGGGGAGCGCCCGCCGAGCGC No data
Right 934685935 2:96321771-96321793 CGCGGACGCTGCAGGGAGTGTGG No data
934685929_934685935 5 Left 934685929 2:96321743-96321765 CCGCCGAGCGCCAGCGGGAACAG No data
Right 934685935 2:96321771-96321793 CGCGGACGCTGCAGGGAGTGTGG No data
934685931_934685935 -5 Left 934685931 2:96321753-96321775 CCAGCGGGAACAGCGCATCGCGG No data
Right 934685935 2:96321771-96321793 CGCGGACGCTGCAGGGAGTGTGG No data
934685923_934685935 28 Left 934685923 2:96321720-96321742 CCTCGATGTGCCCAGGGGAGCGC No data
Right 934685935 2:96321771-96321793 CGCGGACGCTGCAGGGAGTGTGG No data
934685928_934685935 6 Left 934685928 2:96321742-96321764 CCCGCCGAGCGCCAGCGGGAACA No data
Right 934685935 2:96321771-96321793 CGCGGACGCTGCAGGGAGTGTGG No data
934685924_934685935 18 Left 934685924 2:96321730-96321752 CCCAGGGGAGCGCCCGCCGAGCG No data
Right 934685935 2:96321771-96321793 CGCGGACGCTGCAGGGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934685935 Original CRISPR CGCGGACGCTGCAGGGAGTG TGG Intergenic