ID: 934685936

View in Genome Browser
Species Human (GRCh38)
Location 2:96321783-96321805
Sequence AGGGAGTGTGGCCCCTCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934685931_934685936 7 Left 934685931 2:96321753-96321775 CCAGCGGGAACAGCGCATCGCGG No data
Right 934685936 2:96321783-96321805 AGGGAGTGTGGCCCCTCCGCAGG No data
934685925_934685936 29 Left 934685925 2:96321731-96321753 CCAGGGGAGCGCCCGCCGAGCGC No data
Right 934685936 2:96321783-96321805 AGGGAGTGTGGCCCCTCCGCAGG No data
934685928_934685936 18 Left 934685928 2:96321742-96321764 CCCGCCGAGCGCCAGCGGGAACA No data
Right 934685936 2:96321783-96321805 AGGGAGTGTGGCCCCTCCGCAGG No data
934685929_934685936 17 Left 934685929 2:96321743-96321765 CCGCCGAGCGCCAGCGGGAACAG No data
Right 934685936 2:96321783-96321805 AGGGAGTGTGGCCCCTCCGCAGG No data
934685924_934685936 30 Left 934685924 2:96321730-96321752 CCCAGGGGAGCGCCCGCCGAGCG No data
Right 934685936 2:96321783-96321805 AGGGAGTGTGGCCCCTCCGCAGG No data
934685930_934685936 14 Left 934685930 2:96321746-96321768 CCGAGCGCCAGCGGGAACAGCGC No data
Right 934685936 2:96321783-96321805 AGGGAGTGTGGCCCCTCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934685936 Original CRISPR AGGGAGTGTGGCCCCTCCGC AGG Intergenic