ID: 934685940

View in Genome Browser
Species Human (GRCh38)
Location 2:96321796-96321818
Sequence GCCTGTGCACGCGCCTGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934685940_934685943 -9 Left 934685940 2:96321796-96321818 CCTCCGCAGGCGCGTGCACAGGC No data
Right 934685943 2:96321810-96321832 TGCACAGGCTCGCATTCTGGAGG No data
934685940_934685944 -8 Left 934685940 2:96321796-96321818 CCTCCGCAGGCGCGTGCACAGGC No data
Right 934685944 2:96321811-96321833 GCACAGGCTCGCATTCTGGAGGG No data
934685940_934685945 17 Left 934685940 2:96321796-96321818 CCTCCGCAGGCGCGTGCACAGGC No data
Right 934685945 2:96321836-96321858 GCGCATCTCAGCCGTGCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934685940 Original CRISPR GCCTGTGCACGCGCCTGCGG AGG (reversed) Intergenic