ID: 934685943

View in Genome Browser
Species Human (GRCh38)
Location 2:96321810-96321832
Sequence TGCACAGGCTCGCATTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934685938_934685943 -8 Left 934685938 2:96321795-96321817 CCCTCCGCAGGCGCGTGCACAGG No data
Right 934685943 2:96321810-96321832 TGCACAGGCTCGCATTCTGGAGG No data
934685940_934685943 -9 Left 934685940 2:96321796-96321818 CCTCCGCAGGCGCGTGCACAGGC No data
Right 934685943 2:96321810-96321832 TGCACAGGCTCGCATTCTGGAGG No data
934685937_934685943 -7 Left 934685937 2:96321794-96321816 CCCCTCCGCAGGCGCGTGCACAG No data
Right 934685943 2:96321810-96321832 TGCACAGGCTCGCATTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934685943 Original CRISPR TGCACAGGCTCGCATTCTGG AGG Intergenic
No off target data available for this crispr