ID: 934685945

View in Genome Browser
Species Human (GRCh38)
Location 2:96321836-96321858
Sequence GCGCATCTCAGCCGTGCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934685938_934685945 18 Left 934685938 2:96321795-96321817 CCCTCCGCAGGCGCGTGCACAGG No data
Right 934685945 2:96321836-96321858 GCGCATCTCAGCCGTGCGCCCGG No data
934685940_934685945 17 Left 934685940 2:96321796-96321818 CCTCCGCAGGCGCGTGCACAGGC No data
Right 934685945 2:96321836-96321858 GCGCATCTCAGCCGTGCGCCCGG No data
934685941_934685945 14 Left 934685941 2:96321799-96321821 CCGCAGGCGCGTGCACAGGCTCG No data
Right 934685945 2:96321836-96321858 GCGCATCTCAGCCGTGCGCCCGG No data
934685937_934685945 19 Left 934685937 2:96321794-96321816 CCCCTCCGCAGGCGCGTGCACAG No data
Right 934685945 2:96321836-96321858 GCGCATCTCAGCCGTGCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934685945 Original CRISPR GCGCATCTCAGCCGTGCGCC CGG Intergenic
No off target data available for this crispr