ID: 934686873

View in Genome Browser
Species Human (GRCh38)
Location 2:96327572-96327594
Sequence ACGTGTGCAAGACTGTGCAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934686868_934686873 13 Left 934686868 2:96327536-96327558 CCATCAAGGCAGCTCTCTGCACC 0: 1
1: 0
2: 2
3: 21
4: 240
Right 934686873 2:96327572-96327594 ACGTGTGCAAGACTGTGCAGTGG 0: 1
1: 0
2: 0
3: 5
4: 128
934686870_934686873 -8 Left 934686870 2:96327557-96327579 CCGGCTTCCACCTAGACGTGTGC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 934686873 2:96327572-96327594 ACGTGTGCAAGACTGTGCAGTGG 0: 1
1: 0
2: 0
3: 5
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934686873 Original CRISPR ACGTGTGCAAGACTGTGCAG TGG Exonic
900179995 1:1307134-1307156 ACGTGTGCACAAGTGTGCATCGG - Intronic
900187884 1:1341044-1341066 AGGTGTGCATGTGTGTGCAGGGG - Intronic
900827067 1:4935364-4935386 ACCTCTGCAAGACTTTGCTGAGG - Intergenic
903283929 1:22265614-22265636 AAGTGTGCATGTGTGTGCAGGGG - Intergenic
905150182 1:35921085-35921107 AAGAGTGCAGGACAGTGCAGAGG - Exonic
910214618 1:84830521-84830543 AAGTGTGTAAGAGTGTGCTGTGG - Intronic
911333641 1:96555004-96555026 AAGTTTGCAAGGCTGTGGAGGGG - Intergenic
917303408 1:173602627-173602649 ACCTGTGCAAATCTATGCAGTGG + Intronic
920762617 1:208800124-208800146 ACCTGTGCCAGCCTGTGCACTGG + Intergenic
923158267 1:231297021-231297043 AGGTGTCTAAGACTGGGCAGGGG - Intergenic
924089847 1:240491092-240491114 ACCTGAGCAAGAATGTGCTGTGG - Exonic
1066277252 10:33881190-33881212 ACTTGAGCAAGACTGCGCAGAGG + Intergenic
1069858699 10:71456637-71456659 ACCTGTGCCAGCCTGTGCTGGGG + Intronic
1071238745 10:83680356-83680378 AGGTGTACAAGTCTGGGCAGTGG - Intergenic
1072977816 10:100074453-100074475 ATGTGGGCAGGACTGTGCAATGG + Intronic
1075847533 10:125556762-125556784 ATCTGTGCAAAACTGAGCAGAGG + Intergenic
1076747678 10:132522625-132522647 ACTTGTTCCAGACTGGGCAGAGG - Intergenic
1079217564 11:18527093-18527115 ATGTGGGCAAGACTGTTCCGAGG + Exonic
1080751380 11:35153374-35153396 GGGTGTGCAAGACTGTGCACAGG - Intronic
1081661548 11:44891612-44891634 GCTTGTGCAAGGCTGGGCAGCGG + Intronic
1083545354 11:63545332-63545354 AAATGTGAAAGACTGTGAAGGGG - Intronic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1085175304 11:74481520-74481542 CCAAGTGCAAGACTGTGCATAGG + Intergenic
1086917534 11:92547884-92547906 ATGTGTGGAGGGCTGTGCAGAGG + Intronic
1086924731 11:92627887-92627909 GAGTGAGCAAGGCTGTGCAGAGG + Intronic
1090495223 11:127205451-127205473 ACCTGTGCAAGACTGGGAATGGG + Intergenic
1090574573 11:128086842-128086864 ACCTGTGCAAGACTGAGAATGGG - Intergenic
1091186141 11:133649569-133649591 ACGTGTGCTTGCCTGTGCTGCGG - Intergenic
1091395512 12:152092-152114 CCGTGTGCAAGGCTGTGCTCGGG - Intronic
1091877451 12:3947847-3947869 AATTGCGAAAGACTGTGCAGTGG + Intergenic
1096523514 12:52197428-52197450 AAGGGTTCAAGACTGTCCAGCGG + Intergenic
1102526789 12:113518299-113518321 GCCTGTGCAAGACTGTAAAGAGG - Intergenic
1109847701 13:68018291-68018313 TCCTATGCAAGACTGTGAAGTGG + Intergenic
1110985078 13:81956777-81956799 GTGTCTGCAATACTGTGCAGGGG - Intergenic
1117329163 14:54695531-54695553 ATGTGACCAAGAGTGTGCAGTGG - Intronic
1121705008 14:95985575-95985597 AGGGGTTCAAGACTTTGCAGAGG - Intergenic
1124044307 15:26134472-26134494 ACGTGTGCAAGAATCTTCGGTGG + Intergenic
1124424812 15:29554876-29554898 ACGTGTGTAAGAATGTTCATGGG - Intronic
1124511937 15:30335114-30335136 ACCATTGCAGGACTGTGCAGAGG + Intergenic
1124730977 15:32195637-32195659 ACCATTGCAGGACTGTGCAGAGG - Intergenic
1129707784 15:77804621-77804643 GTGTGTGCAAGGATGTGCAGGGG + Intronic
1129937223 15:79460721-79460743 ACGTTTGCAACTCTTTGCAGAGG - Intronic
1131983595 15:98018906-98018928 CAGTGTGGAAGACTGTGCAGAGG + Intergenic
1133330559 16:4970651-4970673 ACGTGAGTGAGACTCTGCAGTGG + Intronic
1133435219 16:5773628-5773650 ACGTGAGCAAGAACGTGCATGGG + Intergenic
1137567967 16:49545417-49545439 ACATGTGCAAGACTGGGCCTTGG + Intronic
1137695559 16:50459869-50459891 GCGTGTGCCATAATGTGCAGTGG + Intergenic
1138754319 16:59464994-59465016 AAGTGTGAAAGACAGTGGAGAGG + Intergenic
1141063312 16:80894893-80894915 ACGTGGGTAGGAGTGTGCAGAGG + Intergenic
1141467785 16:84218267-84218289 AGGTATGCAAGACTGTACTGGGG - Intergenic
1142483584 17:233143-233165 ACGTGTGCGTGTGTGTGCAGAGG + Intronic
1143058854 17:4183149-4183171 ACTTGTGCAATACTATGCACTGG + Intronic
1145960247 17:28883029-28883051 AGGTGTGCAGGGCTGGGCAGGGG - Intronic
1146788820 17:35740165-35740187 ATGTGCACAAGACAGTGCAGTGG + Intronic
1152277778 17:79368194-79368216 ACGTGGGCACGGCTGTGGAGAGG - Intronic
1153092276 18:1360949-1360971 AGTTGTGGAAGACTGTGAAGAGG - Intergenic
1157413908 18:47486254-47486276 CTTTGTGAAAGACTGTGCAGTGG - Intergenic
1157452319 18:47798273-47798295 ACTTGTGCAAGGCTGTGGGGAGG - Intergenic
1159493227 18:69165858-69165880 TGGTGTGCAAGACTGTGTGGTGG + Intergenic
1160170058 18:76545340-76545362 ACGGGTGCAAGTGTGTGTAGGGG + Intergenic
1163259923 19:16182849-16182871 ACCTGGAAAAGACTGTGCAGAGG - Intergenic
1164772419 19:30819934-30819956 ACGCCTGCAAGTGTGTGCAGAGG + Intergenic
1165997768 19:39856786-39856808 AAGTGTGCAAAACTTTGCGGAGG + Intergenic
1166363616 19:42267671-42267693 ACGTGTGAAAGAATGTGCTAGGG - Intergenic
925688684 2:6497775-6497797 ATGTGTGGAGGACTTTGCAGGGG - Intergenic
927564976 2:24104226-24104248 ACCTGTGCAAGACTGGGAATAGG + Intronic
927607732 2:24503023-24503045 ATGTGTGTAAGACACTGCAGAGG - Intronic
931018966 2:58020856-58020878 ACATGTGCTATACTATGCAGTGG - Intronic
933116174 2:78475389-78475411 AAGTGTGCAACACTCAGCAGAGG - Intergenic
933615479 2:84478689-84478711 AAGAGAGCAAGACTGGGCAGTGG + Intergenic
934686873 2:96327572-96327594 ACGTGTGCAAGACTGTGCAGTGG + Exonic
936075672 2:109400199-109400221 ATGTGTGCAAGTGTGTGTAGGGG - Intronic
937960751 2:127456294-127456316 ACGTGTTCAAAGCAGTGCAGGGG + Intronic
941882933 2:170500056-170500078 CCATGAGCAAGACTGTGTAGGGG + Intronic
943073965 2:183172661-183172683 ACCTGTGCAAGACTGAGAACAGG - Intergenic
944715365 2:202372002-202372024 AGGGATGCAAGACTGGGCAGAGG - Intergenic
948975438 2:241460857-241460879 ACGTGTGCAGGACTCTGGCGGGG + Intronic
948993939 2:241569076-241569098 AGGTTTACAAGGCTGTGCAGTGG + Intronic
1169119150 20:3084873-3084895 ACGTGGGCCTGTCTGTGCAGGGG + Intergenic
1175903244 20:62368092-62368114 ACGCGTGCGCGGCTGTGCAGCGG - Intergenic
1182546926 22:31081885-31081907 ACCTCTTCAAGACTGTCCAGTGG - Intronic
949594939 3:5533128-5533150 ACCTGTGCAAGACTGGGAATGGG - Intergenic
951654645 3:24991933-24991955 CCCTGTGCCAAACTGTGCAGAGG + Intergenic
952858318 3:37791712-37791734 ATGTGGGCAGGACTGTGGAGGGG - Intronic
953376336 3:42431514-42431536 ACGGAAGCAAGACTGAGCAGAGG - Intergenic
955472215 3:59297706-59297728 ACCTGTGCAAGACTGGGAATGGG - Intergenic
957938981 3:86980559-86980581 ACATGTTCAAATCTGTGCAGAGG - Intronic
959150623 3:102602941-102602963 ACATTTGCAAGATTGGGCAGAGG + Intergenic
959658272 3:108835318-108835340 AAATGTGCAAGACTGTGCGTGGG - Intronic
961443098 3:126964414-126964436 ACATGTGCAAGCATGTGCATAGG + Intergenic
967253131 3:187563475-187563497 ATGTGTGCATGTCTGTGTAGGGG - Intergenic
968725109 4:2243340-2243362 ACCTGTGGAAGACTGAGGAGTGG - Intergenic
969565026 4:7972245-7972267 AGGCGTGCAAGGCTGTGGAGGGG - Intronic
976430598 4:84959558-84959580 ACGTGAGGAAGACTGAGGAGTGG + Intronic
977838772 4:101676143-101676165 TCGTGTTCTAGACTGTGAAGGGG - Intronic
978630018 4:110733409-110733431 ACCTGTGATAGACTGTGAAGGGG - Intergenic
978967383 4:114757301-114757323 ACGTGTGCATGTCTGTGCCTTGG + Intergenic
981639804 4:146927831-146927853 ACATGTGCAAGGCTATGAAGGGG + Intronic
985564912 5:610799-610821 GTGTGTGCAACAGTGTGCAGGGG - Intergenic
985730604 5:1545634-1545656 ATGTGTGCAGGTGTGTGCAGAGG - Intergenic
985730616 5:1545740-1545762 ATGTGTGCAGGTGTGTGCAGAGG - Intergenic
986546157 5:8899749-8899771 CTGTGTGCAAGAATGTGTAGGGG + Intergenic
989106214 5:37865510-37865532 ACGTGTGCACACGTGTGCAGAGG - Intergenic
990617639 5:57523624-57523646 CCTTCTGCAAGACTGTGCATAGG - Intergenic
992314407 5:75537309-75537331 ACCTGTGCAAGACTGGGAATGGG - Intronic
993977178 5:94496750-94496772 ACATGGGCCAGACTGTACAGGGG + Intronic
995927514 5:117392806-117392828 ATGTGCTTAAGACTGTGCAGTGG - Intergenic
999200708 5:149814300-149814322 ACGTGTGAATGACTTTCCAGAGG - Intronic
999498144 5:152120250-152120272 ACGTGTGGAAGACTTCACAGAGG + Intergenic
1000353477 5:160371066-160371088 ATGTGTGTGTGACTGTGCAGGGG + Intergenic
1000353482 5:160371137-160371159 ATGTGTGTATGACTGTGCAGTGG + Intergenic
1000841658 5:166227077-166227099 ATGTGTCTAAAACTGTGCAGAGG + Intergenic
1001220041 5:169892746-169892768 AGGTGTGCAAGACAGCACAGAGG + Intronic
1008005078 6:46401901-46401923 ACTTGTGAAAGACAGGGCAGAGG + Intronic
1008751371 6:54737305-54737327 ACCAGTGCAAGACTGAGCATGGG - Intergenic
1017758378 6:157549105-157549127 AGGTGGGCAGCACTGTGCAGCGG - Intronic
1018187096 6:161274695-161274717 GTGTGTGCACGCCTGTGCAGTGG - Intergenic
1019031693 6:169018873-169018895 ACCTGTGCAAGACTGGGAACAGG - Intergenic
1028981370 7:96971074-96971096 CTTTGTACAAGACTGTGCAGGGG + Intergenic
1029807099 7:103009478-103009500 ACTTGTGCAAGACTGGGAATGGG + Intronic
1034020761 7:147639857-147639879 ATGTGTGCAAGACTGTGTCCGGG + Intronic
1036178482 8:6562734-6562756 ACGTGTCCAATGCTGTGCAGAGG - Exonic
1041450046 8:57995837-57995859 ATGTGTGCCAGATTTTGCAGAGG - Intronic
1047341059 8:123980963-123980985 AAGTGTGCAAGAGGGGGCAGAGG - Intronic
1061992211 9:134165444-134165466 ACACGTGCATGAATGTGCAGAGG - Intergenic
1189295106 X:39912312-39912334 CCGTCTGCAAATCTGTGCAGAGG - Intergenic
1189872934 X:45403915-45403937 ACCTGTGCAAGACTGGGAATGGG + Intergenic
1192849855 X:74943049-74943071 ACCTGTGCAAGACTGGGAATGGG - Intergenic
1193859993 X:86653424-86653446 ACCTGTGCAAGACTGGGAATGGG - Intronic
1194012884 X:88584125-88584147 ACCTGTGCAAGACTGAGAACTGG + Intergenic
1194981864 X:100449702-100449724 ACCTGTGCAAGACTGGGAACAGG + Intergenic
1199574585 X:149301138-149301160 ACCTGTTCTAGACTCTGCAGTGG - Intergenic
1202353784 Y:24023945-24023967 ACATGTGCAAAAGTGTGCATCGG - Intergenic
1202516995 Y:25646170-25646192 ACATGTGCAAAAGTGTGCATCGG + Intergenic