ID: 934689255

View in Genome Browser
Species Human (GRCh38)
Location 2:96345687-96345709
Sequence GGACATGGTGAAGTGTCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934689250_934689255 27 Left 934689250 2:96345637-96345659 CCAAGGAGAGAGGGTAGGCTTAG 0: 1
1: 0
2: 0
3: 13
4: 216
Right 934689255 2:96345687-96345709 GGACATGGTGAAGTGTCATGAGG 0: 1
1: 0
2: 0
3: 21
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934689255 Original CRISPR GGACATGGTGAAGTGTCATG AGG Intronic
900559379 1:3296155-3296177 GGTCATGGTGGAGCGTCCTGGGG + Intronic
900922832 1:5684552-5684574 GGGCATGGAGAAGAGTCACGTGG - Intergenic
902220483 1:14961340-14961362 TGACATGGTGTAGTGTCCAGGGG + Intronic
902588803 1:17458830-17458852 GAACATGGTGAAAGGTCTTGTGG - Intergenic
903248463 1:22034437-22034459 GGACATTGTCAAATGTCCTGGGG + Intergenic
905641167 1:39591023-39591045 GGAGAGAGTGAAGTGTCATGTGG + Intergenic
909914006 1:81295287-81295309 GGACATGGTGATGGGCCATGAGG - Intergenic
913107741 1:115629920-115629942 GGACATGGAGAAGTGGGGTGAGG - Intergenic
914975486 1:152357058-152357080 GGTCATGGTGGTCTGTCATGTGG - Exonic
915287972 1:154864869-154864891 GGGCATGGGGAAGTGGCTTGAGG + Intronic
918542925 1:185650746-185650768 GGACATAGTGAAGGGCCATGAGG + Intergenic
919956016 1:202416807-202416829 GGACATGGTGAAGTTTCTGGTGG + Exonic
922031882 1:221809190-221809212 AGACATGCTCAAGTGTCATCTGG + Intergenic
1064002032 10:11671771-11671793 GGACATGATGAAGCGTAGTGAGG - Intergenic
1067563098 10:47317628-47317650 GGACAGGGGGAAGGGACATGAGG + Intergenic
1075425676 10:122340007-122340029 GAGCTTGGTGAATTGTCATGAGG + Intergenic
1075514999 10:123101502-123101524 GGGCATGGGGAAGTGGCAAGGGG - Intergenic
1076031991 10:127167417-127167439 GGAATTGATGAAGTGTCAAGAGG + Intronic
1076168494 10:128301267-128301289 GGCCAGGGTGATGTGTCATGAGG + Intergenic
1076763380 10:132616728-132616750 TGACATGGCGATGTGTCATGTGG + Intronic
1076979126 11:195919-195941 GGACCTGGTGAGGGGACATGGGG + Intronic
1076979154 11:195994-196016 GGACCTGGTGAGGGGACATGGGG + Intronic
1076979185 11:196071-196093 GGACCTGGTGAGGGGACATGGGG + Intronic
1076979222 11:196161-196183 GGACCTGGTGAGGGGACATGGGG + Intronic
1076979237 11:196200-196222 GGACCTGGTGAGGGGACATGGGG + Intronic
1076979251 11:196238-196260 GGACCTGGTGAGGGGACATGAGG + Intronic
1076979282 11:196315-196337 GGACCTGGTGAGGGGACATGGGG + Intronic
1076979297 11:196354-196376 GGACCTGGTGAGGGGACATGGGG + Intronic
1076979313 11:196392-196414 GGACCTGGTGAGGGGACATGGGG + Intronic
1076979329 11:196430-196452 GGACCTGGTGAGGGGACATGGGG + Intronic
1076979345 11:196468-196490 GGACCTGGTGAGGGGACATGGGG + Intronic
1077551060 11:3200543-3200565 GGAGGTGGTGAAGAGTCAGGGGG - Intergenic
1078205606 11:9226763-9226785 GGACATGGTGATGAATTATGGGG - Intronic
1078837765 11:15048138-15048160 TGAAATGGTGAAATGTCATTAGG - Intronic
1081513388 11:43799897-43799919 GGGCATGGTGATGTGTGATATGG - Intronic
1084191220 11:67499837-67499859 GGACAGGGGGCTGTGTCATGGGG + Intronic
1090119450 11:124009683-124009705 GGACATGGGGAAGGTCCATGAGG - Intergenic
1091148140 11:133299009-133299031 GGACTTGGTGTAGTATCATAGGG + Intronic
1093065772 12:14656739-14656761 GGACATGGTGTTCTGTCATTGGG - Intronic
1099274776 12:80560888-80560910 GGACATGGTTAATTGTCCTCAGG + Intronic
1103302271 12:119937186-119937208 GACCATGGTGATGTGTAATGGGG - Intergenic
1104883013 12:132084900-132084922 GGACTGGGTGAAGGGTCATGAGG - Intronic
1105917830 13:24933345-24933367 GGACATGTGGAATTGTCCTGCGG - Intergenic
1108204916 13:48078606-48078628 GGAGAGGGTGCAGTGTAATGTGG - Intronic
1110184238 13:72654801-72654823 GGACAGGTTGCAGTCTCATGGGG - Intergenic
1110523024 13:76503362-76503384 GGAGATGGTTATGTGTCATGTGG + Intergenic
1110525093 13:76526687-76526709 GGACTTCCTGAAGTGTCCTGAGG + Intergenic
1110668486 13:78146749-78146771 CAAAATGGTGAAGTGTCAAGTGG - Intergenic
1111882495 13:93975088-93975110 GGACATGTTGAATTGGAATGGGG + Intronic
1115717166 14:36118930-36118952 GGAAATGGCCAAGTATCATGAGG + Intergenic
1117313043 14:54547626-54547648 GGACATGGTGGAGGGGCCTGTGG - Intergenic
1120809513 14:88789453-88789475 GAAAATGATGAAATGTCATGTGG + Intronic
1120809523 14:88789564-88789586 GAAAATGATGAAATGTCATGTGG + Intronic
1120809533 14:88789675-88789697 GAAAATGATGAAATGTCATGTGG + Intronic
1122992793 14:105246337-105246359 GGACATGAGGTAGTGTCATGTGG - Intronic
1128471655 15:67958899-67958921 GGACATGGTTAGGAGTCATTTGG - Intergenic
1130216291 15:81973562-81973584 AGATATGGTGAATTGTAATGGGG + Intergenic
1130787493 15:87116045-87116067 AGACATGATGAAGTGTATTGTGG + Intergenic
1130995028 15:88898879-88898901 AGACAAGGGGAAGTGTCTTGGGG + Exonic
1132170755 15:99651641-99651663 GGCGATGGTGCAGTGACATGTGG - Intronic
1135970456 16:27068411-27068433 GGCCAGGATGAAGTTTCATGTGG - Intergenic
1141912813 16:87071565-87071587 GGACTTGGTGCAGTGTGGTGAGG - Intergenic
1142466616 17:140737-140759 GGACCTGGTGAGGGGACATGGGG + Intergenic
1142466719 17:140992-141014 GGACCTGGTGAGGGGACATGGGG + Intergenic
1142466735 17:141030-141052 GGACCTGGTGAGGGGACATGGGG + Intergenic
1142466751 17:141068-141090 GGACCTGGTGAGGGGACATGGGG + Intergenic
1142466813 17:141223-141245 GGACCTGGTGAGGGGACATGGGG + Intergenic
1142466855 17:141323-141345 GGACCTGGTGAGGGGACATGGGG + Intergenic
1142466871 17:141361-141383 GGACCTGGTGAGGGGACATGGGG + Intergenic
1142466922 17:141493-141515 GGACATGGTGAGGGGACATGGGG + Intergenic
1143443536 17:6994232-6994254 GGACATGGAGAAATAGCATGCGG + Intronic
1143678307 17:8455039-8455061 GGGCATCATGAAGTGTCATCTGG - Intronic
1146271210 17:31487243-31487265 GGGCATGGTTAAGAGTGATGGGG + Intronic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1147950958 17:44107808-44107830 GGACACTGGGAAGTGCCATGGGG - Intronic
1148245127 17:46025370-46025392 GGACATTGTGACGTGTGATGAGG - Exonic
1149755433 17:59181947-59181969 GGACATGAAGAAGTGTTCTGAGG - Intronic
1158982687 18:62779815-62779837 GGACTTGCTGAAGTATCATCAGG + Intronic
1160226255 18:77013799-77013821 GGACATGGTGATGTGCCACTTGG - Exonic
1161313894 19:3609007-3609029 GGCCATGGTGGAGAGTCATGGGG + Intergenic
1163702056 19:18790949-18790971 GGACCTGGTGAGGCGTCATGGGG + Intronic
1164159346 19:22616508-22616530 GCACATGCTGAACTGTGATGTGG + Intergenic
1164426593 19:28147267-28147289 CTACATGTTAAAGTGTCATGGGG + Intergenic
1165121055 19:33558794-33558816 GGATGTGGTGGAGTGTCAGGCGG + Intergenic
1168234944 19:55056761-55056783 AGACATGGAGAAGTGTGAGGCGG - Exonic
926817816 2:16817630-16817652 TGACTTGGTCAAATGTCATGTGG + Intergenic
929757785 2:44781875-44781897 GGAAATGGTTAAGCTTCATGAGG + Intergenic
934025992 2:88001970-88001992 GGTCATTGTGAAGTGGCAGGTGG - Intergenic
934136433 2:89000487-89000509 GGTCAGAGTGAAGTCTCATGGGG + Intergenic
934138211 2:89018390-89018412 GGTCAGTGTGAAGTGTCATTGGG + Intergenic
934231036 2:90182236-90182258 GGTCAGTGTGAAGTGTCATTGGG - Intergenic
934689255 2:96345687-96345709 GGACATGGTGAAGTGTCATGAGG + Intronic
940718728 2:157258320-157258342 GGACATGGGAAAGGGGCATGGGG + Exonic
941009387 2:160282213-160282235 GGATATGGGGAAGAGTCATGGGG + Intronic
947338881 2:229116368-229116390 GGGCAGGATGAAGTGCCATGAGG - Intronic
947756458 2:232569342-232569364 GCCCATTGTGTAGTGTCATGTGG + Intronic
948733141 2:239979890-239979912 CGTCATGGTGAGGTGTGATGCGG - Intronic
1169372239 20:5036864-5036886 GGGCTTGGTGAAGTGTTTTGTGG - Intergenic
1178497345 21:33098577-33098599 GGACAAGCTGAAGTGTCTGGGGG + Intergenic
1180066046 21:45413006-45413028 GGGGATGGTGGAGCGTCATGGGG + Intronic
1181172741 22:21019011-21019033 GGAAAAGGTGAAATGTCAGGGGG - Intronic
1182301452 22:29339516-29339538 TGACAAGGCGACGTGTCATGGGG + Intronic
1183585868 22:38752623-38752645 GGACATGATGAGGTGGGATGTGG + Exonic
1184825901 22:46950619-46950641 GGACATGGCGATGTCTCATCAGG + Intronic
950440836 3:13009364-13009386 TGACATGGTGTAATGTCATCAGG + Intronic
951325276 3:21295225-21295247 GGACAAATTGAAGTGTTATGGGG + Intergenic
956031125 3:65039465-65039487 ATACATGATGAAGTGTCAAGGGG + Intergenic
956494702 3:69812265-69812287 GGAAATGGTGCAGTCTCATAGGG + Intronic
956738923 3:72259774-72259796 GGGCATGGGGAAGTGAGATGGGG - Intergenic
961471487 3:127115888-127115910 GGACCTGGTTAAGAGCCATGCGG - Intergenic
965700162 3:171452538-171452560 GGAGATGGTGAGGTTTAATGAGG - Intronic
967222574 3:187260097-187260119 GCAAATGGTGAAGTGTCTTATGG - Intronic
967867718 3:194204085-194204107 GGACAGGGCGAAGTGCCAGGCGG + Intergenic
970805299 4:20023885-20023907 GGACATAATTAAGTGTCATGAGG - Intergenic
974092693 4:57328678-57328700 ACACATGGGGAACTGTCATGGGG + Intergenic
975426253 4:74231347-74231369 GGACATGGAGAAGTTCCAAGGGG + Intronic
975641024 4:76500418-76500440 TGAGATGGTGAAGTGTTCTGAGG - Intronic
975836461 4:78427269-78427291 GGACTCTGTGAAGAGTCATGAGG - Intronic
976528904 4:86127552-86127574 GGAGAAGATGAAGTGTTATGGGG - Intronic
977486550 4:97654552-97654574 GTACATAGTGATGTGTAATGTGG - Intronic
977995084 4:103491880-103491902 GGACATGGTTACAAGTCATGTGG + Intergenic
980984969 4:139686143-139686165 GGACAATGTGAAGTGTGGTGGGG + Intronic
983409398 4:167377768-167377790 GGAGATGGAGAAGCGGCATGGGG + Intergenic
987861765 5:23498242-23498264 GGACATGGTGATGAATAATGGGG + Intergenic
991544629 5:67767773-67767795 AGACATGGAGATGAGTCATGAGG + Intergenic
992371786 5:76151414-76151436 TGACATGGTGAAATGTCATTTGG + Intronic
993046704 5:82874531-82874553 GGCCATGGTGAAATATAATGAGG - Intergenic
996831589 5:127746524-127746546 AGAAATGGGGAATTGTCATGAGG - Intergenic
1001187477 5:169588883-169588905 GGGCTTGGTGTAGTGTCATGGGG - Intronic
1006672816 6:35740221-35740243 GGAAAGGGGGAAGTGACATGTGG - Intronic
1007782131 6:44260386-44260408 GGACTTGGGGATGTGTCAGGTGG + Intronic
1008885947 6:56431834-56431856 GGACTTCGTGAAGTGAAATGAGG - Intergenic
1013923318 6:115437036-115437058 AGACATTCTAAAGTGTCATGTGG - Intergenic
1013985624 6:116189697-116189719 GGCCATGGTGAAATGTTCTGAGG + Intronic
1014782390 6:125579374-125579396 ATACATGGTCAAGTGTCCTGTGG - Intergenic
1014787228 6:125632965-125632987 GGACATGGTAAGCTGTCAGGAGG - Intergenic
1015903585 6:138092898-138092920 GGGCATGGGGAAGTGTGGTGGGG + Intronic
1017800201 6:157888778-157888800 GGGCATGGTGATGTGGGATGTGG + Intronic
1020290832 7:6721137-6721159 GGACATGAGGAAGTGTTGTGAGG - Intergenic
1021873873 7:25030550-25030572 AAACATGGTGAAGGGTCATTGGG - Intergenic
1023891183 7:44393068-44393090 GGGCATGGTGCCCTGTCATGGGG - Intronic
1024343370 7:48289122-48289144 TGCCTTGGTGAAGTGTCAGGAGG + Intronic
1025986996 7:66462694-66462716 GGACATGGAGAAGCGGCATTTGG - Intergenic
1026028025 7:66762750-66762772 GGACATGGAGAAATGGCATTGGG + Intronic
1026483839 7:70800971-70800993 TGACATGGGGCAGTGTCATGGGG - Intergenic
1027132939 7:75604295-75604317 GGACATGGTTAAGTTCCAGGGGG + Intronic
1027210266 7:76141519-76141541 GGACATGGAGAAGCGGCATTTGG - Intergenic
1027650408 7:80860360-80860382 AGACATGGTAATGTGTCTTGAGG - Intronic
1029117603 7:98245235-98245257 GCTCATGATGAAGTGGCATGGGG - Intronic
1030221731 7:107105612-107105634 GGAGATGGTAAGGTGTCATTGGG + Intronic
1030579002 7:111328786-111328808 GGGCACGTTGAAGTTTCATGTGG - Intronic
1031180062 7:118402880-118402902 GGACATGGTCATGTGTCTTCCGG + Intergenic
1033241392 7:139682623-139682645 GGACATGGTGCAGGGTGCTGTGG - Intronic
1035920671 8:3672647-3672669 TGACATGGTGCAGTGTCACTGGG + Intronic
1040328040 8:46370098-46370120 GGACATTTTGAAGTGTTTTGAGG - Intergenic
1040372845 8:46794434-46794456 AGACATGCTGAGGTGTCAGGTGG + Intergenic
1041531776 8:58876614-58876636 GGACATAGGGAATTGTCCTGCGG + Intronic
1041828318 8:62123557-62123579 GGACATGGTAGAATGCCATGTGG - Intergenic
1044524754 8:93239938-93239960 GGATGTGGAGCAGTGTCATGTGG - Intergenic
1046066349 8:109201483-109201505 GCACATGGTGAAGAAACATGTGG - Intergenic
1046588764 8:116180262-116180284 AGACATGGTGAGGTATCTTGGGG - Intergenic
1048155065 8:131939348-131939370 GCAAATGGTGAAGTGTCTAGTGG - Intronic
1049346574 8:142142433-142142455 AGAGATGCTGAAGTGTCCTGAGG + Intergenic
1052187025 9:25610632-25610654 AGAGAAGGTGAAGTGTCAAGAGG - Intergenic
1052384440 9:27807341-27807363 GGACAGGGAGAAGTGTCTGGAGG + Intergenic
1053114814 9:35490857-35490879 GGACACGGGGAACTGTCCTGGGG + Intronic
1055272843 9:74581144-74581166 GGGCCTGGTGAATTTTCATGAGG - Intronic
1057307422 9:93920411-93920433 GGACACGGTGACGGGTGATGGGG + Intergenic
1059469531 9:114494105-114494127 GGGTATGGTGAAGTGTCAGTGGG + Intronic
1059953659 9:119493843-119493865 GGACATGGGGAGGTGTCTGGAGG + Intergenic
1060032828 9:120230541-120230563 AGACATGTGAAAGTGTCATGGGG + Intergenic
1060381135 9:123173806-123173828 GGACATTGTGTGGTGTAATGAGG - Exonic
1062381274 9:136288028-136288050 GGACATGATGAAGTGAGATGAGG + Intronic
1186375948 X:9001471-9001493 GGAAATGGTGAATTGTCCAGTGG + Intergenic
1192049441 X:67710511-67710533 GGAGATGGTGTATTGTCTTGTGG + Intronic
1196376468 X:115038601-115038623 GGACATGGAGAAGGATCATCTGG + Intergenic
1200337070 X:155362098-155362120 GGAGATGGTGAAGTTAGATGTGG - Intergenic
1200349400 X:155479129-155479151 GGAGATGGTGAAGTTAGATGTGG + Intergenic
1200892429 Y:8338075-8338097 GGACATTGTGAAATATCGTGTGG + Intergenic
1202578586 Y:26354376-26354398 GGACATGGTGAAGTTTCTGGTGG - Intergenic