ID: 934690823

View in Genome Browser
Species Human (GRCh38)
Location 2:96357573-96357595
Sequence CTGTGAACTCCAGAGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 1, 2: 2, 3: 20, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934690823_934690825 10 Left 934690823 2:96357573-96357595 CCTTCTACCTCTGGAGTTCACAG 0: 1
1: 1
2: 2
3: 20
4: 214
Right 934690825 2:96357606-96357628 TTGTTACTTAATAACATGCTAGG 0: 1
1: 0
2: 1
3: 14
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934690823 Original CRISPR CTGTGAACTCCAGAGGTAGA AGG (reversed) Intronic
900402650 1:2478909-2478931 CTGTGACCTCCCCAGCTAGATGG - Intronic
900614210 1:3557236-3557258 CTGTGATCTCTAGTCGTAGAAGG - Intronic
900722777 1:4188404-4188426 CTGAGAACTCCAAAGGTGGGGGG - Intergenic
901536745 1:9887372-9887394 CTGTCAACTCCTGAGCCAGAAGG - Intronic
902237845 1:15068988-15069010 CTGAGAACTGCTGGGGTAGATGG - Intronic
902262877 1:15239987-15240009 GTGTGAACACCAGAGGTAATTGG - Intergenic
903864680 1:26389573-26389595 CAGGGAACGCCAGGGGTAGAGGG - Intergenic
903945202 1:26958478-26958500 TTGTAAACTCCTGAGGTTGAGGG - Intronic
906692482 1:47801687-47801709 CTCTGAAGTCCAGAGGGAGGAGG - Intronic
907054471 1:51352148-51352170 CTGTGAACTCCTGAGCTCAAGGG - Intergenic
907091628 1:51730153-51730175 CTGAGAACTCCCAAGGAAGAGGG - Intronic
907528363 1:55068311-55068333 CTGTGTTCTCCAGAAGTACAGGG - Exonic
908415303 1:63907597-63907619 CAGTGAACTTTAGAAGTAGAAGG - Intronic
908795960 1:67832264-67832286 CTCTGAACACCAGAGGTAGAAGG - Intronic
910239038 1:85066407-85066429 GTGTGAACTCAGGAGGCAGACGG - Intronic
910452464 1:87360945-87360967 CTTTGAACACCAGAGGTGGAGGG + Intergenic
911549810 1:99264804-99264826 CTGTGAAATCTAGGGGAAGAGGG - Intronic
912641562 1:111351193-111351215 CTGGGAAGACCAGAGGCAGAGGG + Intronic
913003434 1:114604914-114604936 CTCAGAACTCAAGAGGTAAATGG - Exonic
913256664 1:116960423-116960445 CAGTGAACCCCAGAGGAAGGAGG + Intronic
915460634 1:156068594-156068616 CTGGGAAATCCTGAGGAAGAGGG - Intronic
916185806 1:162131707-162131729 CTGTGAGCTCCAGTGTTATAAGG + Intronic
916653087 1:166849035-166849057 CTGTGATATCCCGAGGCAGACGG - Exonic
917420438 1:174857611-174857633 CTGTGAATTTCAGAGATAGGAGG - Intronic
919962360 1:202484843-202484865 CTGAGAAATCCAGGGGTACAGGG + Intronic
922050685 1:221987744-221987766 CTGTGAAACCCAGTGTTAGATGG + Intergenic
923180558 1:231514568-231514590 CTGGGGACTCCAAAGGTAGAAGG - Intergenic
1063880499 10:10526831-10526853 CTGTGACCTCCAGGGAGAGAAGG - Intergenic
1065287798 10:24202344-24202366 CTCTGAATTCCAAAGGTAGGGGG + Intronic
1065999585 10:31091768-31091790 CTGTCAACTCCAGAAGGAGTGGG + Intergenic
1066002591 10:31118216-31118238 CTGTGACTCCCAGAGGCAGAGGG + Intergenic
1066043881 10:31579725-31579747 CTGTGAACTCCAGAGGCAGAGGG + Intergenic
1070590424 10:77796793-77796815 CTGTGAACACCAGAGGCAGCTGG + Intronic
1072172263 10:92876710-92876732 CTGGGAACTGCAGAGGAAGAAGG - Intronic
1072414115 10:95232586-95232608 CTGTGTCCCCAAGAGGTAGACGG - Intergenic
1073517240 10:104087435-104087457 CTGTGAACTCCATAAGCAGAGGG - Intergenic
1073559744 10:104486705-104486727 CTGTGAACTCCATGAGGAGAGGG - Intergenic
1073726000 10:106231716-106231738 CTTTGAAATCTAGAGGAAGAAGG - Intergenic
1076104085 10:127806406-127806428 CTGTGAATTCCAGAGGCTGCTGG - Intergenic
1076133297 10:128028441-128028463 CTGTGACCTTCAGAGGCAGCTGG - Intronic
1077627575 11:3786877-3786899 CTGCTAACTCCAGACGTAAATGG + Intronic
1079089011 11:17467744-17467766 CTGTGAACTGCAGGGACAGAAGG - Intronic
1082672816 11:56056467-56056489 CTGGGAACTTCATACGTAGATGG + Intergenic
1083349199 11:62015230-62015252 CACTGAACTCCACAGGGAGAGGG + Intergenic
1083386726 11:62316575-62316597 CTGTGAACTCCAGGAGGACAGGG - Intergenic
1083906554 11:65675681-65675703 CTGTGTCCTCAAGCGGTAGAAGG + Intergenic
1085736351 11:79042489-79042511 CTGTGTCCTCCCGTGGTAGAAGG - Intronic
1089059912 11:115618103-115618125 TTGTGAGCTCCAGAGGGGGATGG + Intergenic
1089754357 11:120675322-120675344 ATGTGAACTCCAGACCCAGAAGG - Intronic
1090192864 11:124787660-124787682 ATGTGAACTCTATAGGTAAAAGG + Intronic
1091039834 11:132266596-132266618 CAGAGAACTCAAGAGCTAGAAGG + Intronic
1095510852 12:42950144-42950166 CTGTGAACTCCATAGGAACAAGG + Intergenic
1095782265 12:46072908-46072930 ATGTGGAATCCAGAGGAAGATGG + Intergenic
1095910079 12:47417116-47417138 CTGTGTCCTCCCGTGGTAGAGGG - Intergenic
1096523819 12:52198946-52198968 CTGTGAAGCCCAGAGACAGAGGG - Intergenic
1097683907 12:62674692-62674714 CTGGGAACACCAAAGGTAAATGG + Intronic
1097904859 12:64909264-64909286 CTTTGAGCTCCAGAGATAAAAGG + Intergenic
1100888047 12:99094185-99094207 CTGTAAATTCTAAAGGTAGAGGG - Intronic
1101179842 12:102203709-102203731 CTGTGGACTCCAGCATTAGATGG + Intergenic
1101727356 12:107399126-107399148 CTTTGAACACCAGAGGAAGTAGG + Intronic
1102006823 12:109594527-109594549 CTGAGAAGACCAGAGGTAAATGG + Intronic
1102573687 12:113843012-113843034 CTTGGAACTCCAGAGATAGCAGG - Intronic
1103548069 12:121715738-121715760 CTGTGAATTGAAGATGTAGATGG - Intronic
1104706692 12:130952697-130952719 CTGTGAACTCCAAAGGCCGGGGG - Intergenic
1105767187 13:23573341-23573363 CTTAGAAGTCCAGAAGTAGAAGG - Intronic
1106853195 13:33817965-33817987 CAGTGAACTTCAGAACTAGAGGG + Intergenic
1109011540 13:56954193-56954215 CTGTTAACTCCAGAAGTACCTGG - Intergenic
1109960298 13:69620479-69620501 CTGTGAACTCCATAAGGACAGGG - Intergenic
1111821876 13:93225184-93225206 TTATGCACTCCAGAGGAAGAGGG - Intergenic
1113327694 13:109298376-109298398 GTGTGTTCTCTAGAGGTAGATGG + Intergenic
1115394101 14:32887704-32887726 CTGTGAGCTCCAGAGGTCTAAGG + Intergenic
1115772396 14:36678461-36678483 CTGGGAACTCCAGATGTCAATGG - Exonic
1117578211 14:57123239-57123261 CTGTGTCATCCAGTGGTAGAAGG + Intergenic
1118393457 14:65315914-65315936 CTGTGACTTCCAAAGGTAAAGGG + Intergenic
1118550122 14:66940704-66940726 CTGAGGAATCCAGAGGCAGACGG - Intronic
1119991798 14:79206496-79206518 CTGTTAACTCCAGAGACAGGTGG + Intronic
1120228056 14:81812658-81812680 CTGTGAACTCAAAATGGAGAGGG - Intergenic
1121307288 14:92915011-92915033 CAGTGATCTCCTGAGGTGGAAGG + Intergenic
1121912222 14:97801978-97802000 CTGTGACCTCCTCAAGTAGAAGG + Intergenic
1122076544 14:99238574-99238596 CTGTGAACCACGGAGGTGGAGGG + Intronic
1122674864 14:103404075-103404097 TTGAGAAATTCAGAGGTAGATGG + Intronic
1124173099 15:27395062-27395084 ATGGGAACTCCAGAAGGAGAGGG - Intronic
1125710942 15:41785435-41785457 CAGTGAACTCCAGGAGTAGAGGG + Intronic
1128382600 15:67124354-67124376 GTGTAAACTGCAGAGGTGGATGG - Intronic
1129606600 15:77028162-77028184 CTGGGGACTCCAGGGGTGGAGGG + Intronic
1129664990 15:77574651-77574673 CTGAGAAATCCAGGGGTATATGG + Intergenic
1131251545 15:90834029-90834051 CTCTGAACTGCAGGGGCAGAAGG + Intergenic
1131384461 15:91992073-91992095 CTGTGAACTCCTGTGGCACAGGG - Intronic
1131810134 15:96164561-96164583 CTGTTGAGTCCAGAGGTAGTTGG - Intergenic
1132634317 16:936055-936077 CTTTTCACTCCAGAGGAAGAAGG + Intronic
1133646419 16:7769031-7769053 CTGTGTACCCCAGAGGTAGGTGG - Intergenic
1134748540 16:16607065-16607087 CTGTAAACTCCAGAGGGGCAAGG - Intergenic
1134814931 16:17198129-17198151 CTGGGAACTCACGAGGCAGAAGG - Intronic
1134996925 16:18746551-18746573 CTGTAAACTCCAGAGGGGCAAGG + Intergenic
1136993113 16:35169374-35169396 GTGGGACCTCCAGAGGTGGAGGG + Intergenic
1138087304 16:54144549-54144571 CTCTGAACTCCGGAGTTAGTTGG - Intergenic
1139123460 16:64048373-64048395 CTGTGAACTCCAGTAGTCAAAGG + Intergenic
1140622399 16:76751426-76751448 CAGTGAACTGCAGAAGGAGAAGG + Intergenic
1141055292 16:80808092-80808114 ATGTGGGCTCCAGAGGCAGATGG + Intergenic
1141059755 16:80854946-80854968 CTATGAACTTCAGATATAGAAGG + Intergenic
1141411349 16:83835428-83835450 ATGTCCACCCCAGAGGTAGAGGG + Intergenic
1141670528 16:85489416-85489438 CTGAGAACTGCAGAGGCAGATGG - Intergenic
1142262620 16:89049989-89050011 CTGTGAAATTCGGAGGTGGAGGG + Intergenic
1142590755 17:1004760-1004782 CTGGGAACTCCAGAAGTTGTGGG - Exonic
1146461286 17:33047890-33047912 CTTTGAACTCCTGAGGTAGATGG - Intronic
1147170712 17:38617239-38617261 CTCTGAGCCCCAGAGGTAGCAGG - Intergenic
1147747153 17:42701785-42701807 CTGTGTACTCTGGAGATAGATGG - Exonic
1150634460 17:66903272-66903294 CTGGGAACTCGAGATGAAGATGG + Intergenic
1152022322 17:77786661-77786683 CTGAGAACTCCAGAGAGAGGTGG + Intergenic
1156320153 18:36012981-36013003 CTGTGGTTTCCAGAGGTACAGGG + Intronic
1156518219 18:37698928-37698950 ATGTGATCTCCAGAGTTAGCAGG - Intergenic
1157555218 18:48609081-48609103 CTGTGGACTCTGAAGGTAGATGG - Intronic
1158292692 18:55959143-55959165 TTGTAAACTCCAGAGGTAAGTGG - Intergenic
1158441023 18:57474540-57474562 CTGTGTCCTCCCGTGGTAGAAGG + Intronic
1159691739 18:71496497-71496519 CTGGGAAATCCAGAGGCAAAAGG - Intergenic
1159746646 18:72243714-72243736 CTGTAGAGTCCAGAGTTAGACGG + Intergenic
1160469927 18:79121560-79121582 TTGTAGACTCCAGTGGTAGAAGG + Intronic
1165899348 19:39161602-39161624 CTGTGAACTCCTGAGTCAGGCGG + Intronic
1166856455 19:45784709-45784731 CTGTGAACTACGGAGACAGAGGG + Exonic
1166913955 19:46181489-46181511 ATGTGATCTACAGAGGTAGTTGG - Intergenic
1168721162 19:58555740-58555762 GTGGGACCTCCAGAGGTGGAGGG + Exonic
1168721604 19:58557672-58557694 CTGTGAACCTCAGAGTCAGAGGG - Intronic
926604262 2:14881347-14881369 CTGGGAACTCCAAAAGTAGGGGG + Intergenic
929475667 2:42245175-42245197 ATGTGAACCCCGGAGGTGGAGGG - Intronic
930373388 2:50533191-50533213 CTCTTAAGTCAAGAGGTAGATGG - Intronic
932010116 2:67967940-67967962 CTCTGAACTCCAGAGATTAAGGG + Intergenic
932516777 2:72359356-72359378 CTGTGATCTCACAAGGTAGAAGG - Intronic
932783175 2:74576375-74576397 CTAGGAACTCCAGAGATAGATGG - Intronic
934690823 2:96357573-96357595 CTGTGAACTCCAGAGGTAGAAGG - Intronic
937315230 2:120927948-120927970 CTTTGAAGTCCCCAGGTAGAAGG + Intronic
938576280 2:132607388-132607410 GTATGAAATCCAGAGTTAGAGGG + Intronic
940233084 2:151479112-151479134 CTGTGAACTGCGCTGGTAGATGG + Exonic
940654191 2:156468622-156468644 CTGAGAAATCCAGATGTACAAGG - Intronic
940965541 2:159833208-159833230 CTTTGAACCCAAGAGGTTGAAGG - Intronic
940985751 2:160050384-160050406 CCGTGAACTTCAGAGCTGGATGG + Intronic
942974278 2:181996270-181996292 CTGTGAAAGCCAGAGGTGGAGGG + Intronic
943162702 2:184275920-184275942 ATGTGAAGAGCAGAGGTAGAAGG - Intergenic
943995966 2:194765895-194765917 CTATGAACTGAAGAGGCAGAAGG - Intergenic
1172332185 20:34082821-34082843 CTGAAAACTCCAGAAGGAGATGG + Intronic
1174095008 20:48081660-48081682 CAGAGAAGTCCAGAGGTAGCAGG - Intergenic
1178273465 21:31215215-31215237 CTGTGAAGTCCAGAAGCAGTGGG + Intronic
1179277422 21:39905132-39905154 CTGTGAATACCAGAGGCACATGG + Intronic
1180867738 22:19129060-19129082 CTGTGTACTCCAGATGGAGTGGG + Intergenic
1181750658 22:24986874-24986896 CTGTGACCTCCAGAGGGCAAGGG - Intronic
1181759688 22:25049571-25049593 CTGGAAACTCAAGAGGAAGAAGG - Intronic
1182520666 22:30882832-30882854 CTGTGAACAGCAAAGGTAGGAGG + Intronic
1182805574 22:33067172-33067194 CTCTGAAGTCCAGATGGAGATGG - Intergenic
1183598129 22:38824469-38824491 CTGCGAGGCCCAGAGGTAGAGGG + Intronic
1184902412 22:47456146-47456168 CTGGGCACTCCAGATGCAGATGG + Intergenic
1185221437 22:49630911-49630933 CTGGGGGCTCCAGAGGAAGAGGG - Intronic
950141682 3:10620298-10620320 CTGGGAACTCTGGAGGAAGACGG + Intronic
953682193 3:45047871-45047893 CTGAGAACCACTGAGGTAGAGGG + Intergenic
954152228 3:48663264-48663286 GTGTGAAATCCTGGGGTAGAGGG + Intergenic
961641376 3:128366724-128366746 CTGTGAACTCCCGGGGTGCAGGG - Intronic
961717847 3:128870875-128870897 CTGTCAACTCCAGAGGCTGGAGG - Intergenic
962248584 3:133820186-133820208 CTGTGAACTTCAGAGGCAACTGG - Exonic
963103608 3:141626834-141626856 CTGTGCCCTCCAGAGGCAGGCGG - Intergenic
964412471 3:156413143-156413165 CAGTTAACTGGAGAGGTAGAGGG + Intronic
967621375 3:191638784-191638806 CTGTGAAGACAAGAGGAAGATGG + Intergenic
967882650 3:194312916-194312938 CTGTGAGCTGCAGAGGTAGCCGG - Intergenic
967990463 3:195126532-195126554 TTGAGAACACCAAAGGTAGAAGG - Intronic
968426008 4:523762-523784 CTGAGCACTTCGGAGGTAGAGGG - Exonic
968712304 4:2127655-2127677 CAGAGAATTCCAGAGGCAGATGG - Intronic
969092361 4:4704330-4704352 AGGTCAACTCCAGAGGAAGATGG - Intergenic
969599744 4:8169232-8169254 CTGGGAAGTCCATAGGTAGGTGG - Intergenic
969626665 4:8309130-8309152 CTGCCACCTCCAGAGGAAGAGGG + Intergenic
972640126 4:40917622-40917644 CTGTGAATTATAAAGGTAGAGGG + Intronic
974249639 4:59368457-59368479 CTGTGAACTCCTGGGGTGAAGGG + Intergenic
975644089 4:76529012-76529034 CTGTGAACATCAGCGGCAGATGG - Intronic
979693102 4:123581454-123581476 CTGTGAGCTCCAGACTTAGCTGG - Intergenic
981472204 4:145149266-145149288 CAGTCAACTCCAGAAGTAGGAGG + Intronic
982263636 4:153518342-153518364 CTGTGTCCACCAGGGGTAGAAGG + Intronic
982336875 4:154249880-154249902 CTGTGAACTGCTGAGGGGGAGGG + Intronic
984507105 4:180633624-180633646 CTGGGGACTCCAGAGGGGGATGG + Intergenic
984978211 4:185250382-185250404 CTGTGAACTACACATGTATAGGG - Intronic
985196403 4:187434856-187434878 CTGTGATCCAGAGAGGTAGATGG + Intergenic
985424355 4:189813813-189813835 CAGTGTACTCCACAGGCAGATGG - Intergenic
987738468 5:21874686-21874708 CTGTGAACAGCAGTGGTGGATGG - Intronic
988969970 5:36457268-36457290 CATTGAATTCCAGAGGTACAAGG + Intergenic
990635718 5:57724037-57724059 CTGTGGACTCAAGAGTTAGAAGG - Intergenic
990651883 5:57909507-57909529 CTGTGATCTCCAGAAGAAGCAGG - Intergenic
992556272 5:77906560-77906582 GTGGGGACTCCACAGGTAGAGGG - Intergenic
993313871 5:86374615-86374637 CTGTGAAATCTAGGGGTTGAGGG + Intergenic
994366444 5:98923062-98923084 AGGTGAACTTTAGAGGTAGAGGG - Intronic
995392058 5:111650707-111650729 GTGTGAACTGCAGAAATAGATGG + Intergenic
996828455 5:127712288-127712310 CTTTGATCTCCAGTGTTAGAGGG + Intergenic
997265803 5:132494746-132494768 CACTAAACTCCAGAGGAAGAGGG - Intergenic
998676952 5:144420232-144420254 CAGTAAACTGCTGAGGTAGAGGG - Intronic
1000175364 5:158747001-158747023 CTGTTAAATCTAGAGTTAGAAGG - Intronic
1000346231 5:160316335-160316357 CTGTGAGCTTCAGAGGTTGAGGG - Intronic
1000370561 5:160531953-160531975 GTATGAACCCCAGGGGTAGAGGG - Intergenic
1002352183 5:178590628-178590650 CTGTGGACCCCAGAGGTCGGAGG + Intergenic
1003302251 6:4894108-4894130 CAGAGAAGTTCAGAGGTAGAAGG + Intronic
1003630771 6:7784832-7784854 CTGTGCAATCCCAAGGTAGAAGG - Intronic
1005152259 6:22765665-22765687 CTGAGAACTCCTGAGGCAAAGGG - Intergenic
1006026936 6:31152934-31152956 GTGTGAAGTCCAGTGGTAGCTGG - Intronic
1007576743 6:42929885-42929907 GTGTGAACTCCAGGGGTACCGGG - Intronic
1007943223 6:45801604-45801626 CTGTAAACCACAGAGGTAAAGGG + Intergenic
1008764991 6:54901256-54901278 CTGTAAACTCCAGTGGGACAGGG + Intronic
1009996977 6:70906776-70906798 CTGAGAAACCCAGAGGTGGAAGG - Intronic
1013481324 6:110555372-110555394 CAATGAACTGCAGAGGTAGAGGG - Intergenic
1013921444 6:115409349-115409371 CTGTGAATTCAAGAGCAAGATGG + Intergenic
1015572479 6:134635970-134635992 TTCTCAACTTCAGAGGTAGAGGG - Intergenic
1017454181 6:154585271-154585293 CTGGGAACTTTAGAGGCAGATGG - Intergenic
1017633506 6:156422197-156422219 CTGTGAACTCTATGGGCAGAGGG - Intergenic
1019961318 7:4462260-4462282 CGGTGAACTACAGAGAAAGAAGG + Intergenic
1020142321 7:5619451-5619473 CTGTGAACTCCAAATGCAGATGG - Intergenic
1023259777 7:38346645-38346667 ATGTGTGCTCCAGAGGCAGAGGG - Intergenic
1023261229 7:38360125-38360147 ATGTGTGCTCCAGAGGCAGAGGG - Intergenic
1023509958 7:40941739-40941761 CTGGGAGCTCCAGAGTTAGGTGG + Intergenic
1024776892 7:52798229-52798251 CTGTGAACATCAGAGGTGGGTGG - Intergenic
1024905864 7:54378600-54378622 CAGTGATTTCCAGAGGTAGAGGG - Intergenic
1025029422 7:55545008-55545030 CTGTTAAATCAAGAGCTAGAAGG + Intronic
1027172373 7:75881813-75881835 CTGTAAACTGCAGAGGGAGTCGG - Exonic
1030983061 7:116209662-116209684 CTGAGGACTCCAGAGGTGCAGGG - Intergenic
1033323469 7:140360851-140360873 CTGTGAGCTTCAGAGGGAGATGG - Intronic
1034987553 7:155526294-155526316 ATGTCGACTCCACAGGTAGACGG + Intronic
1038207855 8:25485383-25485405 CAGGGAACTCCAGAGTAAGATGG - Intronic
1039471201 8:37814741-37814763 CTGTAATCTCCGGAAGTAGAGGG + Intronic
1042801734 8:72725732-72725754 CTGTGAACTCCATAGGAGCAAGG + Intronic
1045468764 8:102492452-102492474 CTGAGAACCCCAGAGGTACAAGG - Intergenic
1046210034 8:111060022-111060044 CCCTGAAATTCAGAGGTAGATGG + Intergenic
1047536353 8:125723644-125723666 TTTTGAACCTCAGAGGTAGAAGG + Intergenic
1048251192 8:132868146-132868168 CTGTGAGCTGCAGAGGGAAACGG + Exonic
1048865979 8:138762218-138762240 CTGCGAACCCCAGAGCTGGAGGG - Intronic
1053272179 9:36757897-36757919 CTGTGGAAACCAGAGGTTGAAGG - Intergenic
1056794228 9:89646573-89646595 CTGTACACTGCAGAGATAGAAGG - Intergenic
1056796294 9:89660948-89660970 GGGTGACCTCCAGAGGGAGAAGG + Intergenic
1057144299 9:92748056-92748078 CAGGGAACTCCAGGGGTACAGGG + Intronic
1058475746 9:105330893-105330915 CTTTGAACTTAAAAGGTAGATGG - Intronic
1058543383 9:106035433-106035455 TTGTGAACTGCCAAGGTAGAGGG - Intergenic
1061640539 9:131951351-131951373 CTGAGAACTCCACAGGGGGAAGG + Intronic
1185452352 X:289440-289462 CTGAGAGCTGCAGAGGGAGAGGG + Intronic
1186889784 X:13948633-13948655 CTGTGAACTCCAGAGGCCCTTGG - Intergenic
1188748475 X:33875843-33875865 CTGTGAATCCCAGTGGGAGAAGG + Intergenic
1193208094 X:78772686-78772708 CTGACAACTCCAGTGTTAGAGGG - Intergenic
1194858918 X:98970326-98970348 CTGTGAAGTCAAGAGTTAAAGGG + Intergenic
1195458821 X:105100634-105100656 TAGTGAACTCCAGAGGTGGTAGG + Intronic