ID: 934695907

View in Genome Browser
Species Human (GRCh38)
Location 2:96400012-96400034
Sequence CTGTTGCTGAGGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934695907_934695915 18 Left 934695907 2:96400012-96400034 CCCTCTTCCCTCCTCAGCAACAG No data
Right 934695915 2:96400053-96400075 AGCTGAAGACTGCACCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934695907 Original CRISPR CTGTTGCTGAGGAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr