ID: 934697405

View in Genome Browser
Species Human (GRCh38)
Location 2:96410041-96410063
Sequence TGCCTGGCGGGGAGCCCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934697405_934697418 19 Left 934697405 2:96410041-96410063 CCCTTGGGGCTCCCCGCCAGGCA No data
Right 934697418 2:96410083-96410105 CCAGCCACCTCCTGCTCTCAGGG No data
934697405_934697412 -5 Left 934697405 2:96410041-96410063 CCCTTGGGGCTCCCCGCCAGGCA No data
Right 934697412 2:96410059-96410081 AGGCAGGCACTGACCTCCCGCGG No data
934697405_934697416 18 Left 934697405 2:96410041-96410063 CCCTTGGGGCTCCCCGCCAGGCA No data
Right 934697416 2:96410082-96410104 TCCAGCCACCTCCTGCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934697405 Original CRISPR TGCCTGGCGGGGAGCCCCAA GGG (reversed) Intergenic