ID: 934699740

View in Genome Browser
Species Human (GRCh38)
Location 2:96430062-96430084
Sequence GCTTCAACTCAGAAGGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934699740_934699746 -10 Left 934699740 2:96430062-96430084 CCCTACCCCTTCTGAGTTGAAGC No data
Right 934699746 2:96430075-96430097 GAGTTGAAGCAGGAGCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934699740 Original CRISPR GCTTCAACTCAGAAGGGGTA GGG (reversed) Intergenic
No off target data available for this crispr