ID: 934706976

View in Genome Browser
Species Human (GRCh38)
Location 2:96488406-96488428
Sequence CCAACAAAATAGAACTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934706976_934706979 11 Left 934706976 2:96488406-96488428 CCAACCAAGTTCTATTTTGTTGG No data
Right 934706979 2:96488440-96488462 TGTCTTAATTTGCACTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934706976 Original CRISPR CCAACAAAATAGAACTTGGT TGG (reversed) Intergenic
No off target data available for this crispr