ID: 934709995

View in Genome Browser
Species Human (GRCh38)
Location 2:96508505-96508527
Sequence CCGCACGCTGGAGTGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934709995_934710009 10 Left 934709995 2:96508505-96508527 CCCGCGCCCACTCCAGCGTGCGG No data
Right 934710009 2:96508538-96508560 CCGGGAGCCCAGCCCAACCTGGG No data
934709995_934710003 -9 Left 934709995 2:96508505-96508527 CCCGCGCCCACTCCAGCGTGCGG No data
Right 934710003 2:96508519-96508541 AGCGTGCGGCCCAGCGGGACCGG No data
934709995_934710010 11 Left 934709995 2:96508505-96508527 CCCGCGCCCACTCCAGCGTGCGG No data
Right 934710010 2:96508539-96508561 CGGGAGCCCAGCCCAACCTGGGG No data
934709995_934710007 9 Left 934709995 2:96508505-96508527 CCCGCGCCCACTCCAGCGTGCGG No data
Right 934710007 2:96508537-96508559 ACCGGGAGCCCAGCCCAACCTGG No data
934709995_934710004 -8 Left 934709995 2:96508505-96508527 CCCGCGCCCACTCCAGCGTGCGG No data
Right 934710004 2:96508520-96508542 GCGTGCGGCCCAGCGGGACCGGG No data
934709995_934710013 21 Left 934709995 2:96508505-96508527 CCCGCGCCCACTCCAGCGTGCGG No data
Right 934710013 2:96508549-96508571 GCCCAACCTGGGGCACTGTCAGG No data
934709995_934710017 29 Left 934709995 2:96508505-96508527 CCCGCGCCCACTCCAGCGTGCGG No data
Right 934710017 2:96508557-96508579 TGGGGCACTGTCAGGCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934709995 Original CRISPR CCGCACGCTGGAGTGGGCGC GGG (reversed) Intergenic