ID: 934712967

View in Genome Browser
Species Human (GRCh38)
Location 2:96527656-96527678
Sequence CTGGGGGTGGGGAGGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934712967_934712985 9 Left 934712967 2:96527656-96527678 CCCTCCCCCCTCCCCACCCCCAG No data
Right 934712985 2:96527688-96527710 CGCTGCCCGCCCCCCAAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934712967 Original CRISPR CTGGGGGTGGGGAGGGGGGA GGG (reversed) Intergenic
No off target data available for this crispr