ID: 934714818

View in Genome Browser
Species Human (GRCh38)
Location 2:96537346-96537368
Sequence TTTCCTGAAAGGGGCTGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 106}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934714810_934714818 -3 Left 934714810 2:96537326-96537348 CCTTTCCTCTGCGGCCGCCGTTT 0: 1
1: 0
2: 1
3: 8
4: 77
Right 934714818 2:96537346-96537368 TTTCCTGAAAGGGGCTGCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 106
934714809_934714818 -2 Left 934714809 2:96537325-96537347 CCCTTTCCTCTGCGGCCGCCGTT 0: 1
1: 0
2: 0
3: 4
4: 100
Right 934714818 2:96537346-96537368 TTTCCTGAAAGGGGCTGCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 106
934714806_934714818 17 Left 934714806 2:96537306-96537328 CCGGGTCCAGAGCGCGCGGCCCT 0: 1
1: 0
2: 0
3: 10
4: 102
Right 934714818 2:96537346-96537368 TTTCCTGAAAGGGGCTGCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 106
934714811_934714818 -8 Left 934714811 2:96537331-96537353 CCTCTGCGGCCGCCGTTTCCTGA 0: 1
1: 0
2: 0
3: 8
4: 159
Right 934714818 2:96537346-96537368 TTTCCTGAAAGGGGCTGCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 106
934714807_934714818 11 Left 934714807 2:96537312-96537334 CCAGAGCGCGCGGCCCTTTCCTC 0: 1
1: 0
2: 0
3: 14
4: 156
Right 934714818 2:96537346-96537368 TTTCCTGAAAGGGGCTGCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 106
934714804_934714818 30 Left 934714804 2:96537293-96537315 CCGGGCACAGACTCCGGGTCCAG 0: 1
1: 0
2: 1
3: 19
4: 193
Right 934714818 2:96537346-96537368 TTTCCTGAAAGGGGCTGCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934714818 Original CRISPR TTTCCTGAAAGGGGCTGCGC GGG Intronic
900297769 1:1960480-1960502 TTCCCTGAAAGGGGCTGAGAGGG - Intronic
900412364 1:2518519-2518541 GTTCCTGAAAGGAGCTGAGCAGG - Exonic
900637633 1:3673830-3673852 TTTCCAGAGAGGGGCTTCCCAGG + Intronic
907429128 1:54401144-54401166 TTTCCTGAAGGGGACTGCTATGG + Intronic
913324248 1:117612810-117612832 TTTCCTGATAAGGCCTGGGCAGG + Intronic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
915531102 1:156502704-156502726 TTTCCTGAAAGGGGGGGGTCAGG - Intergenic
917844161 1:179006489-179006511 TTACATGAAAGGGGCTTCTCTGG - Intergenic
920008871 1:202853320-202853342 TTTCCTGGAAGGGTCTGTACAGG + Intergenic
922026653 1:221756002-221756024 TTTCCTGAAAGTACCTGCTCTGG - Intergenic
1065843958 10:29729375-29729397 TCTTCTGAAAGGAGCTGGGCTGG + Intronic
1073564386 10:104522647-104522669 TTCCCTGAATGGGGCAGGGCAGG + Intergenic
1076904301 10:133354660-133354682 GTTCCTGAAAGGGGGTGCCTGGG - Intergenic
1077107967 11:850061-850083 CCTCCGGAGAGGGGCTGCGCCGG - Intronic
1077145339 11:1041928-1041950 TGTCCTGAGAGGGTCTGCCCAGG - Intergenic
1078485592 11:11720294-11720316 ATACCTGAAAGGGGCAGAGCTGG + Intergenic
1081993870 11:47351558-47351580 TTTACTGAGAGGGGCTGCAGGGG - Intronic
1090260591 11:125315982-125316004 TGTCCTCAAGGAGGCTGCGCTGG + Intronic
1091544947 12:1495382-1495404 TTTCCTGACAGTGGCTTCTCTGG - Exonic
1091821088 12:3475698-3475720 TGTCCTGAAAGGGCCTGAGCAGG + Intronic
1092283250 12:7113489-7113511 TGTCCTGAAAGGGGAAGGGCAGG + Intergenic
1094007887 12:25774732-25774754 TTCCCTGGAAGGGGCTCCTCAGG - Intergenic
1096022942 12:48337349-48337371 TTTCCTGGAAGAGGATGCCCAGG + Exonic
1097761256 12:63467514-63467536 TTTACTTACAGGGGCTGCTCTGG - Intergenic
1099963298 12:89417847-89417869 TTTCTTGAAATGGGCTGCTGAGG + Intergenic
1104814464 12:131637801-131637823 TTTCCTGAATGGGTCTGGGTGGG + Intergenic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1109339654 13:61039586-61039608 ATGTCTGAAAGGGGCTGTGCTGG + Intergenic
1114715448 14:24819191-24819213 TTTCCTGAAAGGAGGAGAGCAGG + Exonic
1122006168 14:98705678-98705700 TTTCCTGAAAAGGACTGCTCAGG - Intergenic
1124881013 15:33642706-33642728 TTTTGTGATAGGGGCTGCGATGG - Intronic
1125715464 15:41817474-41817496 TTTCCTGAGAGGGGCGGGACAGG + Intronic
1126743026 15:51797324-51797346 TTTCCTGGAAGGTGCTGGGAGGG + Intronic
1129640873 15:77376547-77376569 TTTCCAGAAAGAGGCTGTTCAGG - Intronic
1129894271 15:79091802-79091824 TTTCCTTCACAGGGCTGCGCGGG - Intergenic
1132536710 16:485230-485252 TTTTCAGAAACAGGCTGCGCAGG + Intronic
1132616045 16:841626-841648 GTTCCTGCATGGGGCTGCCCAGG + Intergenic
1132837787 16:1963117-1963139 TGTCCTGGAGGGGGCTGCGCTGG - Intronic
1133190572 16:4130733-4130755 TTAGCTGAAAGGGGCTGCCAGGG + Intergenic
1138681297 16:58685132-58685154 TTTCCTGCAAGGGAGTGGGCTGG + Intergenic
1138915424 16:61457820-61457842 TTTCCTGGAAGGGGTGGCGGGGG - Intergenic
1139305961 16:65986613-65986635 TTTCGTGAAAGGGTCTGTTCAGG + Intergenic
1139426946 16:66887052-66887074 TTTCCTGAGAGGTGGTGGGCAGG + Exonic
1140780714 16:78294014-78294036 TTTCCTGAAAGGTGATTCACAGG + Intronic
1141803215 16:86324737-86324759 TCTCCAGACAGGGGCTGCACAGG - Intergenic
1145790046 17:27620891-27620913 TTTCCTCGAAGGGGCTGGGCAGG - Intronic
1146213094 17:30957118-30957140 TTTCCCCCAAGGGGCTGTGCGGG - Intronic
1147767425 17:42846102-42846124 TTTCCTGAAAGGGGGAGAGGAGG + Exonic
1152816555 17:82411573-82411595 TTCCCTGGAAGGGCATGCGCCGG - Intronic
1160791020 19:923815-923837 TTCCCCCAAAGGGGCCGCGCAGG - Intergenic
1161057888 19:2199807-2199829 TTTCTTCACAGGGGCTGGGCGGG + Intronic
1162049918 19:8026871-8026893 TTTACAGCAAGGGGCTGCTCTGG + Intronic
1163612926 19:18310357-18310379 TCTCCTGACAGGGCCTGCGCTGG + Intronic
1166560491 19:43729498-43729520 TGTGCTGAAAGGGGCTGGGATGG + Exonic
1167236989 19:48321279-48321301 GGTCCTGAAAGGGGCGGAGCCGG + Intronic
926300578 2:11599271-11599293 TTCCCTGAAAGAGGCTCCGTGGG + Intronic
929548682 2:42875262-42875284 TTGCCTGAAATGGGCTTTGCCGG + Intergenic
934714818 2:96537346-96537368 TTTCCTGAAAGGGGCTGCGCGGG + Intronic
941261511 2:163304499-163304521 ATTTCTGAAGGGGGCTGGGCTGG - Intergenic
942653956 2:178195139-178195161 TTCCCTGAAAGGTGCGGCGTAGG - Intronic
948658179 2:239489803-239489825 TTGCCTGGAGGGGGCTGAGCAGG + Intergenic
1168738737 20:169274-169296 TTTGCTGAAAGGTGCTGTGGTGG - Intergenic
1170539129 20:17370710-17370732 CTTCCTTAAAGGGACTGCCCTGG + Intronic
1175482960 20:59324426-59324448 CTTCCTGAAAGAGGCAGCGGGGG - Exonic
1181388226 22:22559557-22559579 TTTCCTGAAAGGGGTCGGGGGGG + Intronic
1181805019 22:25369503-25369525 TTTCCTGCAAGGGGGTGGGTGGG - Intronic
1182691322 22:32165574-32165596 TTTACTAAATGGGGCAGCGCAGG + Intergenic
1185375605 22:50481525-50481547 TTTCCAGCAAGGGGCGGAGCCGG - Intergenic
950112903 3:10431834-10431856 TTTCCAAAAAGGGGGTGGGCTGG + Intronic
961393550 3:126570638-126570660 CCTCCTGGAAGGGGCTGGGCTGG + Intergenic
963253447 3:143121446-143121468 TTCCCTGCAGGGGGCAGCGCGGG + Exonic
967866607 3:194195122-194195144 TATTCTGCAAGGGGCTGCCCTGG + Intergenic
968845976 4:3041766-3041788 TTTCCTGAACTGTGCTTCGCAGG + Intergenic
969521183 4:7678575-7678597 TTTCCTGGAAGAGGCTGAGCAGG + Intronic
971247672 4:24945024-24945046 TGTCCTAGAAGGGGCTGCACAGG - Intronic
972325779 4:38014254-38014276 TTACCTGCCAAGGGCTGCGCTGG - Intronic
976381256 4:84401864-84401886 TATCCTGAAGGGGGCTGCCTTGG - Intergenic
977784957 4:101022209-101022231 TGTCCTGAAAGGGCCTGGTCAGG + Intergenic
988713525 5:33802281-33802303 TTATCTGAAAGGGGCTGTGTTGG + Intronic
998386851 5:141762184-141762206 TTTCCCGAAAGTGGCTTCACGGG - Intergenic
999907982 5:156164438-156164460 TTTCATGAAAGGAGCTGCAAGGG - Intronic
1000112165 5:158119245-158119267 TGTTCTGAAGGGGGCTGTGCTGG + Intergenic
1001536995 5:172504981-172505003 TTTCCTGGAAGGGGCTGGATTGG + Intergenic
1003685709 6:8299954-8299976 TTTCCTGAACAGGGCAACGCAGG - Intergenic
1006936792 6:37724200-37724222 TTTTCTGCAGGGGGCTGGGCGGG - Intergenic
1012586073 6:100923993-100924015 TTTCCGGAAAGAAGCTGCTCTGG + Intergenic
1013283026 6:108656479-108656501 TTTCCTGGAAGGGGCCGCCCTGG + Intronic
1014313221 6:119830909-119830931 TTTCCAGACAGCGGCTGAGCAGG + Intergenic
1015075976 6:129158143-129158165 CTTCCTGAAATGTGCTACGCTGG - Intronic
1019285390 7:220670-220692 ATTCCTGCAAGGGCCTGTGCTGG + Intronic
1019750355 7:2725298-2725320 TCTCCTAGAAGGGGCTGCCCTGG + Intronic
1020074501 7:5248784-5248806 TGGCCTGGAAGGGGCTGCTCTGG - Intergenic
1020105367 7:5420198-5420220 TTTCCCGAGACGGGCTGCCCAGG - Intronic
1025204601 7:56985023-56985045 TGGCCTGGAAGGGGCTGCTCTGG + Intergenic
1025667336 7:63591912-63591934 TGGCCTGGAAGGGGCTGCTCTGG - Intergenic
1028709418 7:93890615-93890637 TTTCCTGACGGAGGCTGCACTGG - Exonic
1029390536 7:100271562-100271584 TTTCGGGAAGGGGGCTGCGATGG + Intronic
1029403106 7:100357488-100357510 CTCCCTGAAAGAGCCTGCGCTGG + Intronic
1029405722 7:100373229-100373251 CTCCCTGAAAGAGCCTGCGCTGG + Intronic
1030537176 7:110783019-110783041 TTTCCTGAAAGGATATGAGCTGG + Intronic
1036587483 8:10137754-10137776 TTACCTGGAAGGGGCAGGGCAGG - Intronic
1037934170 8:22903518-22903540 GTTCCTGAATGGGGCTGCAGGGG + Intronic
1039505247 8:38047337-38047359 TTTCCTGAAAGTAGGTGTGCTGG - Intronic
1039967502 8:42293803-42293825 TTTCCTGGAATGGCCGGCGCTGG + Intronic
1042368811 8:67967769-67967791 TTCCCTGAAAGGGGATGGGAAGG + Intronic
1044701432 8:94968657-94968679 TTTCCTGGAAGGTTCTGCACAGG + Intronic
1047769514 8:128019477-128019499 TTGCCTGAAATCGGCTGCGGTGG - Intergenic
1049228945 8:141472286-141472308 TGTCATGATAGGGGCTGCACTGG + Intergenic
1049655009 8:143793474-143793496 TTGCCTGTGAGGGGCTGAGCTGG + Intronic
1049748781 8:144273932-144273954 TCTCCTGTGAGGGGCTGCTCAGG + Intronic
1050108797 9:2193681-2193703 TTTCCTGCAGAGGGCTGGGCAGG + Intergenic
1056643470 9:88389172-88389194 CATCAGGAAAGGGGCTGCGCGGG - Intronic
1057865652 9:98678416-98678438 TTTCCTGCGAGGTGCTTCGCTGG + Intronic
1061857212 9:133448905-133448927 AGTCCTCAAAGGGGCTGGGCCGG - Intronic
1062414006 9:136439002-136439024 TTTCCTGCAAGGAGGTGCTCAGG + Exonic
1186705938 X:12139006-12139028 TTTCGAGGTAGGGGCTGCGCGGG + Exonic
1200094446 X:153650615-153650637 CTTCCTGAAGGGGGAAGCGCAGG - Exonic