ID: 934715853

View in Genome Browser
Species Human (GRCh38)
Location 2:96542835-96542857
Sequence ATGTGTGAGCTGAGGGTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 268}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934715853 Original CRISPR ATGTGTGAGCTGAGGGTAGC AGG Intronic
900352362 1:2241326-2241348 ATGAGTGAGCTGTGGATAACTGG - Intronic
900610298 1:3541852-3541874 GGGGGTGAGCTCAGGGTAGCAGG - Intronic
901457264 1:9370302-9370324 GTGTGTGGTCTGAGGATAGCTGG - Intergenic
904961495 1:34336671-34336693 AGGTGTGAGCTGAATGGAGCTGG + Intergenic
905876653 1:41435884-41435906 CTGTGTGGGCTGAGGGTGGCAGG - Intergenic
908786226 1:67736946-67736968 ATGTGTAAACTGAGGGTTGGAGG + Intronic
909820004 1:80050527-80050549 ATGGGTGAGTGGTGGGTAGCTGG - Intergenic
914244592 1:145876309-145876331 AGGTGTGAGGGGAGGGGAGCCGG - Intronic
914676228 1:149909357-149909379 ATGGGTGAGCTGAAGGGAGGTGG - Intronic
916443346 1:164848830-164848852 CTGTGTGTGCTCAGGGGAGCAGG + Exonic
917010236 1:170462921-170462943 ATGCCTGAGTTGAGGGTAGTGGG - Intergenic
918765162 1:188472587-188472609 ATGTGTAAGCAGAGGGTTGAAGG + Intergenic
921926189 1:220711720-220711742 ATGTGTGTGTTGAGGGGAGTGGG - Intergenic
923936788 1:238770516-238770538 ATGTTTGAGTTGAGAGTAACTGG + Intergenic
924743605 1:246812704-246812726 ATGTGGTCGCTGAGGGTAGGGGG - Intergenic
924872236 1:248061096-248061118 ATGTGTGTGCTGATGATAACAGG + Exonic
1067455193 10:46414228-46414250 GTGGGTGAGCTGAGGGTAAGGGG - Intergenic
1067529335 10:47059136-47059158 ACGTGTGGGCTGAGGAGAGCAGG + Intergenic
1067632007 10:47970406-47970428 GTGGGTGAGCTGAGGGTAAGGGG + Intergenic
1069989170 10:72303939-72303961 ATGGGAGAGCTGAGTGTAGCAGG + Intergenic
1070150818 10:73803806-73803828 AAGTCTGTGCTGAGGGAAGCTGG + Intronic
1070814828 10:79316600-79316622 TTGTGTGTGCAGAGGGTAACAGG - Intergenic
1071250306 10:83811560-83811582 ATGTGTGAGCTGAGCTGTGCAGG - Intergenic
1073605919 10:104895544-104895566 GAGTGTGAGCTGAGGGATGCTGG - Intronic
1074121057 10:110494910-110494932 AGGTCTGGGGTGAGGGTAGCAGG - Intergenic
1074558618 10:114515189-114515211 AATTGTGAGCTCAGGGTAGCTGG - Intronic
1075928218 10:126270756-126270778 ATGTGTGAGCTCCTGGTAGTGGG + Intronic
1075988003 10:126804808-126804830 ACGTGTGGGCTGAGGGAAGGAGG - Intergenic
1076462025 10:130654338-130654360 AGGTGTGAGCTGAGGGCTGGGGG + Intergenic
1076481901 10:130790244-130790266 ATGTGTGGGTTGAGGGTGGTGGG - Intergenic
1076481908 10:130790296-130790318 ATGTGTGGGTTGAGGGTGGTGGG - Intergenic
1076481921 10:130790400-130790422 ATGTGTGGGTTGAGGGTGGTGGG - Intergenic
1077501460 11:2911439-2911461 AGGTGTGAGGTGTGGGGAGCCGG + Intronic
1077629906 11:3804347-3804369 ATGAGTGAGCTGGGGGTGGGTGG + Intronic
1078426706 11:11257351-11257373 ATGTTTGATATCAGGGTAGCAGG + Intergenic
1078971558 11:16418618-16418640 ATGAGAGAGCTAAGGATAGCTGG - Intronic
1079095657 11:17508480-17508502 TCATGTCAGCTGAGGGTAGCAGG - Intronic
1080599276 11:33806871-33806893 AGGTGAGAGCTGAGGGATGCTGG + Intergenic
1081707956 11:45196701-45196723 CTGTGTGTGGTCAGGGTAGCGGG + Intronic
1081749392 11:45498988-45499010 TTGTGGAAGCTGAGGGCAGCTGG - Intergenic
1083628241 11:64082801-64082823 ATGTCTGAGCTGAGGGAAACAGG - Intronic
1083640911 11:64144790-64144812 ATGTGTTTGCTGAGGCTTGCCGG - Intronic
1083706439 11:64519568-64519590 AGGTGTGAGCTGAGAGAGGCAGG + Intergenic
1084850563 11:71936355-71936377 AAGGGTGAGCTGGGGGTGGCAGG - Intronic
1086606504 11:88702404-88702426 CTGTGAGAGCTGAGCGAAGCAGG - Intronic
1089328134 11:117671402-117671424 ATGTGTGTGCTGGGTTTAGCAGG - Intronic
1091002242 11:131919421-131919443 ATGTGTGAGCTGAAGGGAGAAGG + Intronic
1091208072 11:133834179-133834201 AGGTGAGAGCTGGGGGTGGCAGG - Intergenic
1091340773 11:134811664-134811686 ATGTGGGAGATGAGGGTGGCAGG + Intergenic
1095507175 12:42910150-42910172 ATGTGTGAGGCTAGGGTAGGAGG - Intergenic
1096418013 12:51430483-51430505 ATGTGTGAGGAGAGGGTGGAGGG - Intronic
1097316158 12:58173424-58173446 ATGTGTGACCTCACGTTAGCAGG + Intergenic
1099888966 12:88566211-88566233 ATGTGTCTGCTGAGGTCAGCAGG + Intronic
1099985462 12:89657826-89657848 ATGAGTGAGTTGAGGATGGCTGG + Intronic
1101349345 12:103914005-103914027 ATGTGTGTCCTGGGGGTAGGAGG - Intergenic
1103052310 12:117790869-117790891 AGGTGTGAGGTGAGGGTATTTGG - Intronic
1104374129 12:128249147-128249169 CGGTGTGAGCTGGGGTTAGCTGG + Intergenic
1104486784 12:129158142-129158164 AAGTGAGAGATGACGGTAGCAGG + Intronic
1104762367 12:131305174-131305196 AGGTGTGAGTAGAGGGTCGCTGG - Intergenic
1104817409 12:131655622-131655644 AGGTGTGAGTAGAGGGTCGCTGG + Intergenic
1104986765 12:132601570-132601592 GTGGGTGAGCTGAGGTTTGCAGG - Intergenic
1106444056 13:29808368-29808390 ATGTGTGAGGTGGGGGGAGTGGG - Intronic
1107589407 13:41886267-41886289 ATGTGAGAGATGAGGCTGGCAGG - Intronic
1109193208 13:59350117-59350139 GTGTGTGTGGTGGGGGTAGCGGG + Intergenic
1110758865 13:79208011-79208033 AAGTGCCAGCTGAGGGTAGGAGG + Intergenic
1112403738 13:99099484-99099506 ATGAGTGAACTGAGGAGAGCAGG - Intergenic
1112724439 13:102286306-102286328 ATGGGTGAGCTTTGGGCAGCAGG - Intronic
1112823966 13:103370306-103370328 CAGTGGGAGATGAGGGTAGCTGG + Intergenic
1113296153 13:108960889-108960911 ATCTTTGAGCAGAGGGTAGCAGG - Intronic
1113738302 13:112693447-112693469 ATGTATGAGCTGTGGGTACGGGG + Intronic
1117119311 14:52551945-52551967 ATCTGTGAGCAGGGGGAAGCTGG - Intronic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1121115202 14:91338447-91338469 CTGTGTGTCCTGGGGGTAGCAGG - Intronic
1121408034 14:93730875-93730897 GGGAGAGAGCTGAGGGTAGCAGG + Intronic
1122141332 14:99664609-99664631 AAGTGGGAGCTGAGGGCAGGGGG - Intronic
1122154388 14:99741697-99741719 AGGTGAGAGCTGGGGGTGGCTGG - Intronic
1122857160 14:104565471-104565493 GCGTGTGAGCTGCGGGAAGCAGG + Intronic
1124425481 15:29559294-29559316 CTGTGTGAGGTGAGGGGAACAGG - Intronic
1125680758 15:41528811-41528833 TTTTGTGAGCAGAGGGAAGCTGG + Intronic
1125740029 15:41956044-41956066 CTGTGTGTGCTGCGGGGAGCTGG - Intronic
1126335481 15:47582591-47582613 ATGTGTGAGCTCAGGGCTGTGGG - Intronic
1128648325 15:69393079-69393101 AAGTGGGAGCTGAGGGGAGAGGG + Intronic
1128789789 15:70424623-70424645 ATGAGTGAGCTGAGGACTGCGGG - Intergenic
1129157055 15:73724763-73724785 ATGTGAGAGCTGAGTCTTGCAGG + Intergenic
1129508792 15:76104735-76104757 ATGTGTGAGGAGAGGGGAGAAGG + Intronic
1129604222 15:77016964-77016986 ATGTGTGTGGTCAGGGGAGCTGG + Intronic
1130475312 15:84261080-84261102 ATGGGTTAACTGAGGATAGCTGG + Intergenic
1130482729 15:84375134-84375156 ATGGGTTAACTGAGGATAGCTGG + Intergenic
1131425959 15:92345633-92345655 ATGTCTGAGTTTAGGGTTGCAGG + Intergenic
1132306700 15:100820149-100820171 ATGTGTCAGCTGCAGGAAGCAGG - Intergenic
1132530505 16:445952-445974 CTGTGTGAGGTGGGGGTAGGTGG + Intronic
1132655748 16:1041072-1041094 AGGTGTGAGCTGGGGGTCTCAGG - Intergenic
1132655756 16:1041099-1041121 AGGTGTGAGCTGGGGGTCTCAGG - Intergenic
1132655764 16:1041126-1041148 AGGTGTGAGCTGGGGGTCTCGGG - Intergenic
1132655811 16:1041280-1041302 AGGTGTGAGCTGGGGGTCTCGGG - Intergenic
1132655820 16:1041307-1041329 AGGTGTGAGCTGGGGGTCTCGGG - Intergenic
1133246286 16:4451028-4451050 ATGTCTGAGCTCAGGGTAAATGG - Intronic
1134147334 16:11776443-11776465 ATGTCAGAGCTGAGGTAAGCTGG - Exonic
1137934745 16:52623929-52623951 TTTTGAGAGCTGAGGGTGGCAGG + Intergenic
1138737375 16:59266020-59266042 AAGTCTGAACTAAGGGTAGCAGG - Intergenic
1139876205 16:70148140-70148162 TTGTGTTAGTCGAGGGTAGCAGG - Intronic
1140721690 16:77777840-77777862 AAATGTGAGCTCAGGGTTGCTGG - Intergenic
1142606449 17:1084020-1084042 GTGTGTGTGCTGGGGGGAGCTGG + Intronic
1143775869 17:9198426-9198448 AAGTGTGAGCTGCGTGCAGCTGG + Intronic
1144119836 17:12141225-12141247 ATGGGAGAGCTGGGAGTAGCTGG - Exonic
1148150013 17:45391398-45391420 AGGTGTGAGCTGAGGCTTGGGGG + Intergenic
1149302427 17:55317683-55317705 AGGTCTGAGCTAAGGGTAGATGG + Intronic
1151950592 17:77351561-77351583 CTGTGTGAGCTGCGGTCAGCAGG + Intronic
1152924961 17:83082943-83082965 ATGTGAGAGGAGAGGGGAGCAGG + Intronic
1154950436 18:21204388-21204410 ATGTGCGTGGTGAGGGTAGGGGG + Intergenic
1155376707 18:25166389-25166411 ATGTGTGGGCTGAAGTTAACTGG + Intronic
1157191720 18:45587562-45587584 ATAGATGAGCAGAGGGTAGCAGG + Intronic
1159730659 18:72023135-72023157 ATGTGTGAGTTGGGGGAAGAGGG - Intergenic
1161347731 19:3776547-3776569 ATGTGTGAGTGGATGGTAGGTGG + Intergenic
1161606088 19:5215687-5215709 ATGGGTGAGCTGTGGTTAGAAGG + Intronic
1161638844 19:5406945-5406967 ATGTGTGAGCTGAGGCTTGAAGG - Intergenic
1162765013 19:12913911-12913933 ATGTGCGAGGAGAGGGAAGCTGG + Intronic
1165610366 19:37146425-37146447 ATTTGAGAGCTGAGGGTGGAGGG + Intronic
1167472946 19:49685586-49685608 ATGTGTGAGCCGGGTGAAGCTGG + Intronic
1167603846 19:50469522-50469544 ACGTGTCAGCTGCGGGTACCAGG - Intronic
925545322 2:5009538-5009560 ATGTTTGAGGTGAGGGATGCGGG - Intergenic
925713005 2:6759694-6759716 GTGTGTGAGCTGAGAGTAGGGGG + Intergenic
925892923 2:8450567-8450589 AGAAGTGAGCTGAGGGTCGCAGG + Intergenic
925962793 2:9034077-9034099 ATATGAGATCTGAGGGTTGCTGG + Intergenic
926455085 2:13057112-13057134 CCGTGTGAGGTGAGGCTAGCTGG + Intergenic
928217121 2:29371070-29371092 ATGTTGGAGCTGAGGGAAGGAGG + Intronic
928234724 2:29529701-29529723 ATCTGTGTGGTGAGGGTAGAAGG - Intronic
930361867 2:50390746-50390768 ATGTGTGTGTTGAGGGGAGGTGG - Intronic
931378173 2:61726955-61726977 ATGTGTGAGCTGAAGTCAGCTGG - Intergenic
931919924 2:67003937-67003959 ATGGGTAAGATGAGGGTAGCTGG + Intergenic
932409093 2:71534745-71534767 AGGTGTGAGTTAAGGGTAGAAGG + Intronic
933782428 2:85811659-85811681 GTGTGTGAGCTGAGGCTCGGCGG + Intergenic
934038839 2:88110933-88110955 ACATCTGAGTTGAGGGTAGCAGG + Exonic
934609916 2:95727482-95727504 ATGTGTGAGGTGGGGGTAGGAGG + Intergenic
934713477 2:96530099-96530121 ATGTGTGAGCTGTGGGCTCCTGG + Intergenic
934715853 2:96542835-96542857 ATGTGTGAGCTGAGGGTAGCAGG + Intronic
934900268 2:98154420-98154442 ATGTGTGCGCTAAGGGAAGAGGG - Intronic
936543243 2:113369059-113369081 ATGTGTGAGGTGGGGGTAGGAGG + Intergenic
937219483 2:120333571-120333593 AAGTGAGAGATGAGGGTGGCTGG - Intergenic
937317752 2:120942715-120942737 AGGAGTGAGCTGAGGTGAGCCGG + Intronic
939137290 2:138312619-138312641 GGGTGTGAGCTGAGAGGAGCAGG + Intergenic
940064684 2:149614162-149614184 GTGTGTGTGGTGGGGGTAGCGGG + Intergenic
942248505 2:174028223-174028245 ATGTGAGGGGTGAGGGCAGCAGG - Intergenic
942374068 2:175317949-175317971 ATGTGTGTGCTGAGGAGGGCAGG + Intergenic
942711649 2:178842971-178842993 GTGTGTGTGTTGAGGGTAGAGGG + Intronic
943982682 2:194574972-194574994 ATTTCTGAGATGTGGGTAGCAGG - Intergenic
944515100 2:200505153-200505175 ATTTGTAAGCAGAGGGTTGCTGG - Intronic
944854016 2:203749078-203749100 ATGTGTGAATTCAGGGTGGCTGG + Intergenic
944908916 2:204290238-204290260 ATGTTTGAGCTGAGAGTTGAAGG + Intergenic
946311010 2:218882628-218882650 CTGTGTAGGCTGAGGGTGGCAGG + Intronic
947740485 2:232482653-232482675 AGCTGTGATGTGAGGGTAGCGGG - Intronic
948271446 2:236676932-236676954 GTGTGTGTGCGGAGGGGAGCAGG + Intergenic
1168803718 20:660901-660923 AAGTCTGAGTTGAGGGTAGGTGG + Intronic
1170566858 20:17612468-17612490 GTGTGTGAGGTGAGGGAGGCTGG - Intergenic
1172613384 20:36267559-36267581 GTGTGGGAGCTGGGGGTTGCAGG + Intronic
1173134089 20:40423942-40423964 ATGTGTGTGCAGAGGGGAGGAGG - Intergenic
1174420700 20:50397270-50397292 ATGTGTGGGGTGAGGGAAACAGG - Intergenic
1175788111 20:61724413-61724435 ATGTGTGAGCTGAGTACAGTGGG + Intronic
1179945054 21:44667644-44667666 ATGTGTGAGCTGAATATAGAAGG + Intronic
1181015949 22:20068861-20068883 AGCTGTGAGCTGAGGGTATGGGG - Intergenic
1181367832 22:22392252-22392274 ATGTCTGAGTCCAGGGTAGCAGG + Intergenic
1181734931 22:24874285-24874307 ATGTGGGAGCTGTGTGGAGCCGG + Intronic
1183274335 22:36883059-36883081 ATGTGAGAGCTGAGGTGATCTGG + Intergenic
1184723288 22:46328488-46328510 ATTTGTGAGCTGAGAGGAACTGG + Intronic
1184803507 22:46776814-46776836 ATGTGTGAGCCGAGAGGGGCAGG + Intronic
1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG + Intergenic
950110808 3:10417401-10417423 ATGGGTGAGCTGAGGATGGATGG + Intronic
951240056 3:20276472-20276494 ATGTGTGAGATGATGGAAGGGGG + Intergenic
951652878 3:24971260-24971282 ATGAGGGAGCTGAGGCTAGGAGG + Intergenic
952254077 3:31680543-31680565 ATCTGTGAAATGAGGATAGCTGG + Intronic
952867013 3:37861486-37861508 ATGGGTGGGGTGAGGGGAGCGGG - Intergenic
952903085 3:38122255-38122277 ATGTGGGGGCTGAGGTTAGGAGG - Intronic
952974331 3:38681312-38681334 ATGGGTGAGCGGTGGGGAGCTGG + Intergenic
953155433 3:40367366-40367388 ATGTGTGTTCTCATGGTAGCAGG - Intergenic
953335285 3:42089286-42089308 AGGTGTGAGATGGGGGTGGCTGG - Intronic
953748861 3:45594766-45594788 GTGTGTGTGTTGAGGGCAGCGGG - Intronic
953929328 3:46998125-46998147 AGGTGGCAGCTGAGGGCAGCGGG + Exonic
954195650 3:48995335-48995357 ATGTGTGAGCAGAGGCCTGCTGG - Intronic
954396560 3:50296354-50296376 AGGTGAGAGGTGAGGGTAGGGGG + Intronic
960389789 3:117063671-117063693 AGGAGTGAGATCAGGGTAGCAGG - Intronic
960623595 3:119659610-119659632 ATGTGTGTGGTGATGGTAGAGGG + Intronic
961194557 3:124990688-124990710 AGGTGTGAACTGAGGGAAGTGGG + Intronic
961795206 3:129404027-129404049 GTGTGGGAGCTGAGGCCAGCAGG + Intronic
963235046 3:142947743-142947765 ATGGGAGAGCTGAGGGGAACTGG - Intergenic
963442857 3:145362626-145362648 ATATATGAGGTGAGTGTAGCGGG - Intergenic
964315199 3:155436228-155436250 ATGTGTAAGGTGGGGGTAGGAGG - Intronic
964398318 3:156272070-156272092 CTGTGTGAGCTGTGTGGAGCTGG + Intronic
966920945 3:184610938-184610960 ATGTCTTAGCTGAGAGAAGCGGG - Intronic
968565532 4:1310725-1310747 ATGTCTGAGTGGAGGGCAGCTGG + Intronic
968685411 4:1954735-1954757 GTGTGTGGGATGAGGGTGGCAGG + Intronic
968917573 4:3503274-3503296 ACATGTGAGCTGCTGGTAGCTGG - Intergenic
969685555 4:8672148-8672170 AAGTCGGAGCTGAGGGCAGCAGG + Intergenic
970435064 4:16025433-16025455 ATGTGGGAGGAGAGGGCAGCGGG - Intronic
970541197 4:17081596-17081618 ATGTGTGAGCTGAGCCTTGAAGG - Intergenic
974025153 4:56727116-56727138 ATGTGTGAGCTGAGTCTTGAAGG + Intergenic
977065158 4:92304871-92304893 AAGTGTGAGGGAAGGGTAGCGGG - Intronic
978685077 4:111431190-111431212 ATGTGGGGGCTGAGGGAAGAGGG + Intergenic
982142014 4:152332659-152332681 ATGTCTGAGCTGCTTGTAGCAGG + Exonic
982636190 4:157899714-157899736 ATGTGTGGGCTGAGGGAGGAGGG + Intergenic
982655160 4:158139341-158139363 ATGAGTGAGCTGAGTGGAGCTGG - Intronic
985510856 5:312969-312991 TTGTGTGAGCTTTCGGTAGCTGG + Intronic
988044391 5:25931299-25931321 TTGTGTGTGCTGAGGTTTGCAGG + Intergenic
990822021 5:59851937-59851959 AAGTGTGGGCAAAGGGTAGCTGG - Intronic
991240708 5:64456998-64457020 ATGTTTAAGCTGAGGGTTGACGG - Intergenic
993785534 5:92130293-92130315 ATTTGTGAGATGAGGGTTGTGGG + Intergenic
994102322 5:95907555-95907577 ATGTGTGGGCTGAGGTGAACCGG + Intronic
995650102 5:114361147-114361169 AAATGTGAGCTGGCGGTAGCGGG + Exonic
996769860 5:127074224-127074246 AGGTTTGTGCTAAGGGTAGCCGG + Intergenic
997093642 5:130885904-130885926 ATATTTGAGCTGAGGGAAACAGG + Intergenic
998266734 5:140672618-140672640 AAGTGTGAGCTGAGCGTTGACGG - Exonic
998388540 5:141772459-141772481 ATGTGTGGGCCGAGGGCAGAAGG + Intergenic
999309421 5:150542345-150542367 ATGAGTGAGCAGAGGGTATTGGG + Intronic
999933599 5:156460648-156460670 ATAAATGAGCTGAGGGTAACAGG - Intronic
1001758079 5:174186067-174186089 ATGTGTCCGCTGAAGGGAGCAGG - Intronic
1002210468 5:177595883-177595905 GTGTGTGAGTTGAGGGTGGGTGG + Exonic
1002275788 5:178103700-178103722 ATCTGAGAGCTGAGGGGACCCGG - Intergenic
1002403353 5:179007347-179007369 AAGTGTGTGCTGAGGGCAACAGG - Intergenic
1002851056 6:996698-996720 AGGTGTGAGCTGAGAGCAGGTGG + Intergenic
1003112589 6:3261978-3262000 ATGTGGGAGTTTAGGGAAGCTGG - Intronic
1003503681 6:6723167-6723189 ATCTGTAAGCTGTGGGTTGCAGG + Intergenic
1004154688 6:13157227-13157249 ATCTTTGAGCTGAGGGGGGCTGG - Intronic
1006079929 6:31559228-31559250 ATGAGCGAGTTGGGGGTAGCCGG + Intergenic
1006986020 6:38176136-38176158 ATGTGTGAGCTGTGGGGTGCAGG + Intronic
1010167363 6:72932286-72932308 ATGTGTGTGATGAGCGTGGCAGG + Intronic
1011755920 6:90498109-90498131 ATGTGTGATCTCAGGATTGCTGG + Intergenic
1014839190 6:126197833-126197855 TTGGGAGAGCTGAGGGCAGCTGG - Intergenic
1015437019 6:133201345-133201367 ATTGGTAAGCTGAGGGTAGAAGG - Intergenic
1016989834 6:149921613-149921635 AGGTGTAAGCTGAGGGTAAGGGG - Intronic
1016993216 6:149943441-149943463 AGGTGTGAGCTGAGGGTGAGGGG + Intronic
1017005117 6:150024090-150024112 AGGTGTGAGCTGAGGGTGAGTGG - Intronic
1017011728 6:150068144-150068166 AGGTGTGACCTGAGGGTGGGGGG - Intronic
1018220944 6:161578982-161579004 ATTTGTGATCTGAGGGATGCTGG - Intronic
1019586650 7:1808497-1808519 ATGTGAGAGCTGCGGGTCCCAGG + Intergenic
1019707464 7:2503339-2503361 ATGTGTCAGCTGAGGGTCTCTGG - Intergenic
1021277073 7:18664630-18664652 ATGTGTGAGGGGTGGGAAGCAGG - Intronic
1021572031 7:22075716-22075738 ATTTGTCAGCTGAGGGTTTCTGG - Intergenic
1022808125 7:33843460-33843482 GTGTGTGAGCTGAGTGAGGCTGG + Intergenic
1024945488 7:54803731-54803753 ATGTGAGAGGTGAGGCCAGCTGG + Intergenic
1025858685 7:65306465-65306487 ATCTGTGTTCTGAGGGTACCTGG - Intergenic
1027183251 7:75953945-75953967 AGATGTCAGCAGAGGGTAGCAGG - Intronic
1029510859 7:100994136-100994158 TTGTGTGAGTTGAGGCTGGCCGG - Exonic
1029511356 7:100997385-100997407 TTGTGTGAGTTGAGGCTGGCCGG - Exonic
1029511579 7:100998807-100998829 TTGTGTGAGTTGAGGCTGGCCGG - Exonic
1029512076 7:101002056-101002078 TTGTGTGAGTTGAGGCTGGCCGG - Exonic
1029598240 7:101548959-101548981 GTGTGGGAGCTGTGGGCAGCCGG + Intronic
1031424991 7:121594643-121594665 AGGTGATAGCTCAGGGTAGCAGG - Intergenic
1032070041 7:128798916-128798938 ACATGTGAGCTCAGGGGAGCAGG + Intronic
1032543626 7:132724483-132724505 ATGTGTGAGCAGAGGTCAGCAGG - Intronic
1033013794 7:137650967-137650989 ATGTGGGAGCTGGAGGTGGCTGG + Intronic
1033139108 7:138809206-138809228 ATGTGAGAGCTGGGCGTGGCAGG + Intronic
1034904618 7:154933247-154933269 ATGTGTGAACTGATGGTGGAGGG - Intronic
1035133239 7:156675238-156675260 AGGGGTGAGCTGAGGGTGGTCGG + Intronic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1037550470 8:19966085-19966107 ATGTGTCAGCTGAGGATTACAGG - Exonic
1037751421 8:21684756-21684778 ATGGGTGAGTTGAGGGTGGCTGG + Intergenic
1038033250 8:23663165-23663187 TTGTCAGAGCTGAGGGTCGCTGG - Intergenic
1038435406 8:27532206-27532228 ATGTGGGGGCTGAGGGGAGAGGG - Intronic
1038439914 8:27564557-27564579 GTGTGTGAGCTGAGGACAGCTGG + Intergenic
1039165170 8:34670933-34670955 ATGTGTGTGGTGGGGGAAGCAGG - Intergenic
1040572775 8:48624862-48624884 ATGAGGGGGCTGAGGGCAGCAGG - Intergenic
1041578121 8:59423063-59423085 ATGTATGAGCAGAGGGCAGGGGG - Intergenic
1042175267 8:66032322-66032344 ATGTGGGACCTGAGTGCAGCTGG + Intronic
1042192266 8:66198916-66198938 ATGTGTGAGGTGGGGGTGGGTGG - Intergenic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1042947491 8:74169832-74169854 ATGTGTGGGCTGGGGGTGGGAGG + Intergenic
1047286193 8:123489147-123489169 ATCTGTGAGATGGGGGTAGTGGG + Intergenic
1048742802 8:137580671-137580693 AGGTGTGTACTGAGGGCAGCAGG - Intergenic
1049101291 8:140580654-140580676 ATGTGTGAGCGGGGGGTCTCAGG + Intronic
1050237397 9:3596378-3596400 ATGTGTTAGCTGAGGGTGAGTGG + Intergenic
1050861397 9:10436969-10436991 ATGTGTGGGCTGAGCTTAACTGG + Intronic
1051717599 9:20001214-20001236 ATGAGTGGGCTGAGGATAGGAGG + Intergenic
1052532525 9:29706120-29706142 ATGTGTGTGCTCAGGGCAGGCGG + Intergenic
1053420622 9:37975285-37975307 ATGTGTGAGCTGGTGGGAACTGG - Intronic
1053456309 9:38235522-38235544 CCGTGTGAGCTGTGGCTAGCAGG + Intergenic
1056306993 9:85300193-85300215 GAGTGTGGGCTGAGGGTAGGAGG + Intergenic
1056318365 9:85413815-85413837 GTGTGTGGGCTTGGGGTAGCTGG - Intergenic
1056318569 9:85415332-85415354 GTGTGTGGGCTTGGGGTAGCTGG - Intergenic
1057220971 9:93257526-93257548 ATGGGTAAGCTGAGGGCAGATGG - Intronic
1057838782 9:98468237-98468259 ATGAGTGAGCTGGGGACAGCTGG + Intronic
1058387096 9:104449682-104449704 ATGTATGAGAAGAGTGTAGCAGG + Intergenic
1058795835 9:108497678-108497700 ATGTGCAAGCAGAGGGTAGTAGG - Intergenic
1060320266 9:122552593-122552615 ATATGTGAGCTGAGGGCAGTAGG - Intergenic
1061226860 9:129285405-129285427 ACCTGTGAGCAGAGGGTACCTGG - Intergenic
1186532219 X:10308901-10308923 ATGTGTGTGGTGAGGGGAGGGGG - Intergenic
1190797753 X:53760307-53760329 ATGGGGGAGCTGAGGGCAGGCGG - Intergenic
1190917403 X:54820907-54820929 ATGGGGGAGCTGAGGGCAGGCGG + Intergenic
1194709735 X:97220601-97220623 ATGTGGGAGCAGATGGCAGCTGG + Intronic
1196199306 X:112867463-112867485 CTGTGTGTTCTCAGGGTAGCAGG - Intergenic
1197091444 X:122542612-122542634 ATGTGTGTGCGGGGGGTGGCAGG - Intergenic
1200775594 Y:7167482-7167504 ATGTGTGTGGCGAGGGGAGCAGG + Intergenic