ID: 934716293

View in Genome Browser
Species Human (GRCh38)
Location 2:96546597-96546619
Sequence TAGGCTACTCACAGCCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 107}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934716293_934716309 29 Left 934716293 2:96546597-96546619 CCAGGATGGCTGTGAGTAGCCTA 0: 1
1: 0
2: 0
3: 6
4: 107
Right 934716309 2:96546649-96546671 GGCCAGAGGAGGCCACCCAGAGG 0: 1
1: 0
2: 3
3: 46
4: 396
934716293_934716307 18 Left 934716293 2:96546597-96546619 CCAGGATGGCTGTGAGTAGCCTA 0: 1
1: 0
2: 0
3: 6
4: 107
Right 934716307 2:96546638-96546660 CCGTGGCCAGGGGCCAGAGGAGG 0: 1
1: 0
2: 4
3: 43
4: 401
934716293_934716303 8 Left 934716293 2:96546597-96546619 CCAGGATGGCTGTGAGTAGCCTA 0: 1
1: 0
2: 0
3: 6
4: 107
Right 934716303 2:96546628-96546650 GAGGAGCTGCCCGTGGCCAGGGG 0: 1
1: 0
2: 3
3: 42
4: 492
934716293_934716301 6 Left 934716293 2:96546597-96546619 CCAGGATGGCTGTGAGTAGCCTA 0: 1
1: 0
2: 0
3: 6
4: 107
Right 934716301 2:96546626-96546648 GGGAGGAGCTGCCCGTGGCCAGG 0: 1
1: 0
2: 4
3: 65
4: 525
934716293_934716300 1 Left 934716293 2:96546597-96546619 CCAGGATGGCTGTGAGTAGCCTA 0: 1
1: 0
2: 0
3: 6
4: 107
Right 934716300 2:96546621-96546643 GGCGAGGGAGGAGCTGCCCGTGG 0: 1
1: 0
2: 1
3: 57
4: 374
934716293_934716302 7 Left 934716293 2:96546597-96546619 CCAGGATGGCTGTGAGTAGCCTA 0: 1
1: 0
2: 0
3: 6
4: 107
Right 934716302 2:96546627-96546649 GGAGGAGCTGCCCGTGGCCAGGG 0: 1
1: 0
2: 16
3: 190
4: 1206
934716293_934716304 15 Left 934716293 2:96546597-96546619 CCAGGATGGCTGTGAGTAGCCTA 0: 1
1: 0
2: 0
3: 6
4: 107
Right 934716304 2:96546635-96546657 TGCCCGTGGCCAGGGGCCAGAGG 0: 1
1: 0
2: 2
3: 48
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934716293 Original CRISPR TAGGCTACTCACAGCCATCC TGG (reversed) Intronic
900334638 1:2155935-2155957 AATGCTCCTCACAGGCATCCTGG - Intronic
902555531 1:17244518-17244540 TAGGCCTCCCACAGCCATTCTGG - Exonic
905734032 1:40314193-40314215 TCAGCTACTCACATCAATCCCGG + Exonic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
910960276 1:92754847-92754869 GAGACCACTGACAGCCATCCTGG + Intronic
911858185 1:102909162-102909184 GAAGCCACTCACACCCATCCTGG - Intronic
919081650 1:192874342-192874364 CTGGCTACTCAGAGCCACCCTGG + Intergenic
921129255 1:212205891-212205913 CACCCTACTCACAGCCAACCAGG + Intergenic
923865232 1:237932430-237932452 TAGGCTGCTCAGATGCATCCTGG + Intergenic
1063241456 10:4174213-4174235 TAGCCTAGTCATTGCCATCCCGG + Intergenic
1063962114 10:11315205-11315227 TTGGCTACTCTCAGGCAACCAGG - Intronic
1065677813 10:28197012-28197034 TTGGCTGCCCACAGCCTTCCTGG + Intronic
1070836495 10:79450253-79450275 TAGGCTCCTCACACCCAGGCTGG - Intergenic
1074565480 10:114573684-114573706 TAGTCCACTCCCACCCATCCAGG + Intronic
1076225536 10:128771972-128771994 TTGGCTGCTCACATCCAGCCTGG + Intergenic
1079935702 11:26613918-26613940 TTGGCTTCTGACAGCCAGCCTGG - Intronic
1084083478 11:66843840-66843862 GAGGGAACTCACAGGCATCCAGG + Exonic
1084505561 11:69564695-69564717 CAGGACACTCACAGCCACCCAGG + Intergenic
1084729237 11:71062580-71062602 CAGGCCACTCTCAGCCATCTGGG - Intronic
1086989555 11:93288043-93288065 CTGACTACTCACTGCCATCCGGG - Intergenic
1086995993 11:93356042-93356064 TAGGCTGCTCACTGCCAAGCTGG + Intronic
1088571320 11:111226754-111226776 TAGGCTACCCACATCCACACTGG + Intergenic
1089757109 11:120695235-120695257 CAGCCTACTCACAGCCATGTTGG - Intronic
1091995207 12:4987844-4987866 GAGGCTATTCACCGCCATCAGGG + Intergenic
1096716277 12:53493274-53493296 TAAGATCCTCGCAGCCATCCCGG - Intronic
1097156469 12:57015764-57015786 GCTGCTATTCACAGCCATCCTGG - Exonic
1102001485 12:109560580-109560602 TGGGCTCCCCACAGCCATGCAGG + Intronic
1102551711 12:113696241-113696263 ATGGCTCCCCACAGCCATCCTGG + Intergenic
1103079233 12:118010208-118010230 AAAGCCAATCACAGCCATCCTGG - Intergenic
1106143213 13:27028448-27028470 TATGCCACAGACAGCCATCCTGG + Intergenic
1113052838 13:106233828-106233850 TGAGCTACTCAAAGCCATACAGG - Intergenic
1115923789 14:38408025-38408047 TAGGCAACACACAAGCATCCAGG + Intergenic
1131095765 15:89653507-89653529 AAGGCTGCTCAAAGTCATCCTGG - Intronic
1135815192 16:25626086-25626108 GATGCTAGTCATAGCCATCCTGG - Intergenic
1139493021 16:67297198-67297220 TGTGCTTCTCACAGCCATGCAGG - Intronic
1142638794 17:1272975-1272997 TACAATCCTCACAGCCATCCTGG - Intergenic
1147602986 17:41757403-41757425 TAGGATACTCACAGCCTCCCAGG + Exonic
1148977649 17:51543741-51543763 TAGGCTACTTCCAGCCATAAAGG - Intergenic
1151583035 17:74990875-74990897 TGGGCCACTCACAGGCAACCAGG - Intronic
1151672265 17:75577696-75577718 TGGGATCCCCACAGCCATCCAGG + Intergenic
1152449130 17:80365360-80365382 TGGGCTGCTCATACCCATCCTGG - Intronic
1152483837 17:80576183-80576205 TAGTCTACTTACAGCCATTGGGG + Intronic
1155942645 18:31815281-31815303 CAGGATACTCACAGCCGTCCTGG - Intergenic
1156646116 18:39164062-39164084 GAGACTACTGACAGCCAGCCTGG - Intergenic
1157152701 18:45234011-45234033 TAGACTACTTACAGCCTTCCAGG + Intronic
1159757210 18:72380364-72380386 TACGTAACTCTCAGCCATCCTGG + Intergenic
1163532780 19:17860342-17860364 TCTGCTTCTCACAGCCATTCCGG - Intronic
1166227923 19:41408526-41408548 TAGGCTTCTCACAGGTCTCCTGG + Intronic
1167522015 19:49960813-49960835 TAGACTCGTCCCAGCCATCCCGG + Exonic
1167523367 19:49969912-49969934 TAGACTCGTCCCAGCCATCCCGG - Intergenic
929580657 2:43079943-43079965 TAGGGTACTCACAGCCTAACTGG - Intergenic
930044751 2:47159764-47159786 GAGGCAACTCACAGGTATCCTGG + Intronic
934716293 2:96546597-96546619 TAGGCTACTCACAGCCATCCTGG - Intronic
935400547 2:102655913-102655935 GAGGCTTCTCACAGCCTTGCTGG - Intronic
936022777 2:109007529-109007551 CAGGCTACTCTCAGACCTCCAGG - Intergenic
937471547 2:122178145-122178167 TTTGGTACTCACAGGCATCCAGG - Intergenic
938067226 2:128287698-128287720 CGGGCTGCTCACAGCCATGCTGG - Intronic
938935322 2:136122554-136122576 TAGGCAATTTAGAGCCATCCTGG + Intergenic
940712560 2:157179922-157179944 CAGACTTCTCTCAGCCATCCTGG + Intergenic
942333178 2:174850905-174850927 TATTGTACCCACAGCCATCCTGG + Intronic
947541352 2:230982004-230982026 GAGGCGACTCACACCCATGCAGG + Intergenic
1173519203 20:43686676-43686698 TGGGCTACACAAAGTCATCCTGG + Intronic
1179294918 21:40053247-40053269 TGGGATACTCACAGACATCTTGG - Intronic
1179987275 21:44928832-44928854 AAGGCTGCCCACAGGCATCCAGG - Exonic
1179987283 21:44928861-44928883 AAGGCTGCCCACAGGCATCCAGG - Exonic
1179987299 21:44928919-44928941 AAGGCTGCCCACAGGCATCCAGG - Intronic
1179987315 21:44928977-44928999 AAGGCTGCCCACAGGCATCCAGG - Intronic
1179987323 21:44929006-44929028 AAGGCTGCCCACAGGCATCCAGG - Intronic
1185394397 22:50579321-50579343 CAGGCTGCCCACAGCCACCCGGG + Intronic
949205793 3:1438206-1438228 TTGGCTACTGACAGCCAGCTGGG + Intergenic
958186217 3:90122569-90122591 TAAGCTAGTCATACCCATCCAGG + Intergenic
961644587 3:128385922-128385944 TGGGCTGCTCACATCCACCCTGG + Intronic
963269985 3:143277050-143277072 TTGGCTCCTCAGAGCCAGCCAGG + Intronic
965523436 3:169691720-169691742 TGGGCAACTCAGAGCCATTCAGG + Intergenic
966945828 3:184776597-184776619 TAGGCTACCTCCAGCCATCCTGG - Intergenic
980661169 4:135860414-135860436 AAGGCTACTCACAGGCAGACAGG - Intergenic
983648838 4:170018988-170019010 TATGCTATCCACAGCCATCCTGG + Intronic
984837690 4:184037266-184037288 TATGCTGTTCCCAGCCATCCAGG - Intergenic
985910740 5:2878689-2878711 GAGGCTCCTCACAGAGATCCAGG - Intergenic
986386832 5:7242947-7242969 CAGGATGCTCACAGCAATCCAGG + Intergenic
994524172 5:100882673-100882695 TAGGCTGCACACAGGGATCCTGG - Intronic
996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG + Intergenic
998087565 5:139339168-139339190 GGGCCTACTCATAGCCATCCTGG + Intergenic
999858283 5:155618998-155619020 TAAGCTACTCAAAGCCATGCAGG - Intergenic
1008560151 6:52715870-52715892 TGGGCTTCTCACAGCCATGGTGG + Intergenic
1011198769 6:84811416-84811438 CAGACTACTTACACCCATCCTGG - Intergenic
1011368548 6:86607410-86607432 GAGGTTTCTCACAGGCATCCAGG - Intergenic
1012587742 6:100944922-100944944 TGGGCTGCTCACAGACATCGAGG - Intergenic
1014679965 6:124416187-124416209 CAGGCTACTCAATGCCATGCTGG - Intronic
1016690511 6:146932533-146932555 TGTGCTACTCACAGCCCTTCTGG + Intergenic
1017771654 6:157649390-157649412 TAGGCCACTCATAGGCTTCCGGG + Intronic
1019181188 6:170188115-170188137 TCTGCTCCTCACAGCCAGCCTGG + Intergenic
1023981633 7:45073932-45073954 TAGGCTACACACAGGCACACAGG - Intronic
1024558961 7:50627859-50627881 CAGGCTCCACACAGCCAGCCTGG - Intronic
1024701785 7:51911659-51911681 TAGGCACCTCACAACCTTCCTGG - Intergenic
1036099902 8:5768253-5768275 TAGACTACCCTCAGCCATTCTGG - Intergenic
1036185846 8:6621955-6621977 CAGGCTACCCAAAGCCACCCCGG + Intronic
1036509384 8:9386604-9386626 TAGGCTGCTAGCAGCCATGCAGG + Intergenic
1037763408 8:21756925-21756947 AAGGCTGCTCTCAGCCAGCCTGG - Intronic
1038230529 8:25695160-25695182 TAGGGTCCTTACAGCCCTCCTGG + Intergenic
1038530747 8:28316550-28316572 TTTTCTACTCACAACCATCCTGG + Intergenic
1042660442 8:71149050-71149072 GTGAGTACTCACAGCCATCCTGG - Intergenic
1044452106 8:92348692-92348714 TACTCTCCTCACAGGCATCCAGG - Intergenic
1045365147 8:101469287-101469309 AAGGTTTCTCCCAGCCATCCTGG - Intergenic
1047212503 8:122851143-122851165 CAGCCTAATCACAGCCTTCCAGG - Intronic
1049228138 8:141467422-141467444 GATGCTGCTCACAGCCGTCCAGG - Intergenic
1051471409 9:17447093-17447115 TGGGCAACTCACTGCCATCAGGG + Intronic
1056786544 9:89596733-89596755 TCGGCTCCACACAGCCATGCAGG + Intergenic
1192130379 X:68544060-68544082 TTGGCCTCTCACAGCCATCTTGG - Intergenic
1195771240 X:108353718-108353740 TACGCTAATCTCAGACATCCTGG - Intronic
1197632415 X:128876631-128876653 TAGGCAACACACTGGCATCCAGG - Intergenic
1199030017 X:142986700-142986722 TGGGCCACTCACAGACATCAAGG - Intergenic
1199673831 X:150167762-150167784 TAGGCTAGTCACCCCCATCTAGG - Intergenic
1200414636 Y:2896075-2896097 GAAGCTACTCACAACAATCCTGG - Intronic