ID: 934717168

View in Genome Browser
Species Human (GRCh38)
Location 2:96550788-96550810
Sequence CGCGGCCACAGGGAGTTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934717168_934717176 16 Left 934717168 2:96550788-96550810 CCCCACAACTCCCTGTGGCCGCG 0: 1
1: 0
2: 0
3: 2
4: 99
Right 934717176 2:96550827-96550849 ATACACAGAACCTGCACCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 198
934717168_934717178 20 Left 934717168 2:96550788-96550810 CCCCACAACTCCCTGTGGCCGCG 0: 1
1: 0
2: 0
3: 2
4: 99
Right 934717178 2:96550831-96550853 ACAGAACCTGCACCCAGGGCGGG 0: 1
1: 0
2: 4
3: 43
4: 293
934717168_934717180 30 Left 934717168 2:96550788-96550810 CCCCACAACTCCCTGTGGCCGCG 0: 1
1: 0
2: 0
3: 2
4: 99
Right 934717180 2:96550841-96550863 CACCCAGGGCGGGACTTGCAAGG 0: 1
1: 0
2: 0
3: 7
4: 112
934717168_934717177 19 Left 934717168 2:96550788-96550810 CCCCACAACTCCCTGTGGCCGCG 0: 1
1: 0
2: 0
3: 2
4: 99
Right 934717177 2:96550830-96550852 CACAGAACCTGCACCCAGGGCGG 0: 1
1: 0
2: 2
3: 32
4: 256
934717168_934717175 15 Left 934717168 2:96550788-96550810 CCCCACAACTCCCTGTGGCCGCG 0: 1
1: 0
2: 0
3: 2
4: 99
Right 934717175 2:96550826-96550848 AATACACAGAACCTGCACCCAGG 0: 1
1: 0
2: 1
3: 9
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934717168 Original CRISPR CGCGGCCACAGGGAGTTGTG GGG (reversed) Intronic
901902116 1:12373950-12373972 TGAGGCCATAGGGACTTGTGTGG + Intronic
902121545 1:14170098-14170120 AGGGGCCAGAGTGAGTTGTGAGG - Intergenic
902989851 1:20179146-20179168 TGAGGCCACAGGGAGCTCTGGGG - Intergenic
905380404 1:37557677-37557699 CTGGGACACAGGGAGTTGAGGGG - Exonic
908383374 1:63617411-63617433 TGCAGCCACAGGCAGTGGTGGGG + Intronic
923596032 1:235361418-235361440 GGCCGCCACAGGAGGTTGTGGGG - Intergenic
924342859 1:243052077-243052099 CTCGGGCACAGGCAGTGGTGGGG - Intergenic
924741204 1:246795111-246795133 CGTGGCCACGGGGAGTGGGGTGG + Intergenic
1065019957 10:21495728-21495750 CGCCGCTACAGGGAGAAGTGCGG + Exonic
1065101969 10:22340609-22340631 CGCGGCCGCAGCGAGTTTTCTGG + Intergenic
1066210026 10:33227480-33227502 AGAGGCCACAGGAAGATGTGGGG - Intronic
1069366449 10:67699230-67699252 AGCAACCACAGGGAGTTGTAGGG - Intergenic
1070719255 10:78745044-78745066 CGACGCCACAGGGAGCAGTGTGG - Intergenic
1072190222 10:93072184-93072206 CGCCGCCACAGGGAGTGTTTCGG - Intergenic
1073552197 10:104414058-104414080 AGAGGCCAAAGGGAGTGGTGGGG + Intronic
1076395717 10:130136349-130136371 CGGGGCCACGGGGAGCTGAGCGG - Intergenic
1077081687 11:727239-727261 CCCAGCCCCAGGGAGTTCTGTGG - Exonic
1077117904 11:893588-893610 CGCTGCCTCAGGGAGGGGTGGGG + Intronic
1077153205 11:1080707-1080729 CGCGGGCACTGGGAGCTGGGGGG + Intergenic
1078363520 11:10688487-10688509 AGAGGCCACAGAGAGTTCTGTGG - Intronic
1078462174 11:11522330-11522352 GTCGGCCACTGGAAGTTGTGTGG - Intronic
1084172402 11:67406816-67406838 CGTGGCCACAGGAGGCTGTGCGG + Exonic
1085469478 11:76748178-76748200 CTGGGCCCCAGGGGGTTGTGGGG - Intergenic
1090205674 11:124882788-124882810 GGAGGCCACTGGGAGTTGAGAGG - Intergenic
1090273902 11:125406292-125406314 CGCAGCCAAGTGGAGTTGTGGGG + Intronic
1091302149 11:134514646-134514668 CTCTGCCACAGGGGGATGTGGGG - Intergenic
1092290200 12:7155829-7155851 GGTGGCCTCAGGGAGGTGTGTGG + Intronic
1097796912 12:63872406-63872428 CGTGGCCACAGGCAAGTGTGGGG - Intronic
1101783797 12:107864256-107864278 CGCGGCCACAGGGAACGCTGAGG - Intergenic
1103944195 12:124517298-124517320 CGCGGCCATAGGGAGGTGGCGGG - Intronic
1105899696 13:24744253-24744275 TGCCTCCACAGGGAGCTGTGGGG + Intergenic
1106585786 13:31055205-31055227 CGTGTGCACAGGGATTTGTGTGG - Intergenic
1111518552 13:89367224-89367246 AGGAGCAACAGGGAGTTGTGAGG - Intergenic
1113563237 13:111300908-111300930 CCCGCCCTCAGGGAGTTGTCTGG - Intronic
1114836214 14:26205322-26205344 CGTGTCCACAGGGAGCTGGGAGG + Intergenic
1119726522 14:76924852-76924874 GGCAGCCACAGGGAGCTGGGCGG - Intergenic
1132062133 15:98700851-98700873 CTCGGAGATAGGGAGTTGTGGGG + Intronic
1133006050 16:2882544-2882566 TCCGGGCACAGGGAGCTGTGGGG - Intergenic
1135972086 16:27079652-27079674 GGAGGCAACAGGGAGTGGTGGGG + Intergenic
1139516968 16:67458006-67458028 CTGGGTCACAGGGAGATGTGGGG - Intronic
1142365033 16:89645676-89645698 AGAGGCCTCAGGGAGTTGTTTGG + Exonic
1146617176 17:34366156-34366178 TGTGGCCACAGGGAGGTGGGGGG - Intergenic
1149578069 17:57727954-57727976 CGAGGCTGCAGGGAGCTGTGAGG - Intergenic
1152511338 17:80791225-80791247 AGCTGCCACAGTGAGTTGTCAGG - Intronic
1152568336 17:81110183-81110205 CCAGGCCACGGGGAGGTGTGTGG - Intronic
1153810527 18:8748055-8748077 GGCGGCCACAAGCAGTTCTGAGG - Intronic
1153944901 18:10009689-10009711 CGCGGCTGCAGGGACATGTGGGG + Intergenic
1157599295 18:48884379-48884401 AGAGGCTCCAGGGAGTTGTGAGG + Intergenic
1160788317 19:912084-912106 CGCGGCCCCGGGGAGGTGGGGGG + Intronic
1160788389 19:912232-912254 CGCGGCCCCGGGGAGGTGGGGGG + Intronic
1161298754 19:3532786-3532808 CGGGGAGGCAGGGAGTTGTGGGG + Intronic
1161423292 19:4187605-4187627 GGCCGCCACAGGGACTTGAGGGG - Intronic
1162560551 19:11416021-11416043 GGCGGCCCCAGGGAGTGCTGAGG - Exonic
1166393500 19:42423317-42423339 CACTGCCACAGGGAGTTGGGGGG - Intronic
924984936 2:262644-262666 GGCGTGCACAGGGACTTGTGAGG + Intronic
925759219 2:7168205-7168227 GGGGGCCACAGGGCCTTGTGTGG + Intergenic
934717168 2:96550788-96550810 CGCGGCCACAGGGAGTTGTGGGG - Intronic
940779678 2:157919296-157919318 CGGGGGCACAGGGAGGTGGGGGG + Intronic
942189419 2:173455934-173455956 CGCGGCCAGAGGAAGAGGTGTGG + Intergenic
1169490546 20:6067815-6067837 TGAGACCACAGGGATTTGTGAGG - Intergenic
1174192331 20:48749274-48749296 CAGGGCCACGGGGAGCTGTGGGG + Intronic
1174487539 20:50870857-50870879 CTCTGCCACAGGGAGTGCTGGGG - Intronic
1175545766 20:59776729-59776751 CGCTGCCACAGAGGGTTTTGAGG - Intronic
1175926522 20:62474168-62474190 CCCGGCCCCAGGGGGCTGTGAGG - Intronic
1183190563 22:36319746-36319768 TGTGGCCCCAGGGAGTTGGGGGG - Intronic
1184176996 22:42794207-42794229 GGCGGCCAGAGGGGGTGGTGAGG - Intergenic
950677143 3:14561169-14561191 AGCAGCCCCAGGGAATTGTGAGG + Intergenic
950690539 3:14652375-14652397 TGCAGGCATAGGGAGTTGTGAGG + Intronic
952155899 3:30643247-30643269 CTGGGCCACAGAAAGTTGTGAGG - Intronic
960993190 3:123324954-123324976 TGAGGCCCCAGGGAGTTGGGTGG - Intronic
969393524 4:6906555-6906577 TGAGGCCACAGAGAGGTGTGAGG - Intergenic
971059043 4:22946592-22946614 TGCTGACACAGGGAGTTGTTGGG + Intergenic
996885358 5:128347498-128347520 CGCGACAACAGGGAGCAGTGGGG - Intronic
997390550 5:133511495-133511517 CGTGGTCACAGCAAGTTGTGGGG - Intronic
999374718 5:151078974-151078996 CGGGGCCCCAGGAAGCTGTGGGG - Intronic
1001037958 5:168311376-168311398 GGCTGCAACAGGGAGGTGTGAGG + Intronic
1002101210 5:176858570-176858592 TGAGGCAACAGGGAGTGGTGGGG + Intronic
1003121336 6:3321241-3321263 CGCGGGCTCAGAGAGGTGTGAGG + Intronic
1007306910 6:40914061-40914083 CACGCAAACAGGGAGTTGTGGGG - Intergenic
1007488225 6:42197340-42197362 CCCGGCCCCAGTGAGATGTGTGG + Intergenic
1018845052 6:167550180-167550202 CGAGGCCACAGGGAGATGGATGG + Intergenic
1019391205 7:787603-787625 CGTGGCCACAGGGATTTCGGGGG + Intergenic
1022842995 7:34182328-34182350 CGCTGCCACAGAGAGTTGGAAGG + Intergenic
1023633295 7:42184327-42184349 TGCAGCCACAGGGAGATCTGCGG - Intronic
1024212205 7:47215756-47215778 CACGGTCTCAGGGAGTTCTGGGG - Intergenic
1025694116 7:63766157-63766179 CAGGGCCACCGGGAGTTGGGCGG - Intergenic
1035587413 8:786542-786564 CGCGGCCACAGAGAGGTGAGTGG + Intergenic
1039089569 8:33813745-33813767 CAAGGCCACAGGGACTTGGGAGG - Intergenic
1040063245 8:43122554-43122576 TGCGGCCACAGGGAGCTGCATGG + Exonic
1048166582 8:132067047-132067069 AGCAGCCACAGGGAGTTGCTGGG + Intronic
1049515786 8:143054551-143054573 CACCACCACACGGAGTTGTGGGG + Intronic
1057037157 9:91819162-91819184 CGCAGCCACAGGGAGCTGGCGGG + Intronic
1058225909 9:102363046-102363068 CGCTGCCACAGAGGGGTGTGTGG + Intergenic
1060157937 9:121333013-121333035 CGATGCCACAGTGAGTTGAGAGG + Intergenic
1186273714 X:7918261-7918283 CCCAGCCACATGGAATTGTGAGG - Intronic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic
1195328764 X:103779560-103779582 CACGGCCAAAGGGAGAAGTGAGG - Intronic
1200032486 X:153307538-153307560 CGGGGCCACAGAGGTTTGTGTGG - Intergenic
1200181988 X:154156216-154156238 CCCAGGCATAGGGAGTTGTGGGG - Intronic
1200187637 X:154193330-154193352 CCCAGGCATAGGGAGTTGTGGGG - Intergenic
1200193286 X:154230470-154230492 CCCAGGCATAGGGAGTTGTGGGG - Intronic
1200199041 X:154268274-154268296 CCCAGGCATAGGGAGTTGTGGGG - Intronic