ID: 934720973

View in Genome Browser
Species Human (GRCh38)
Location 2:96576533-96576555
Sequence GCCTACTAGATAATTACCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934720967_934720973 12 Left 934720967 2:96576498-96576520 CCCATCGTGAAGAGGTCAGTCTG No data
Right 934720973 2:96576533-96576555 GCCTACTAGATAATTACCTAGGG No data
934720965_934720973 20 Left 934720965 2:96576490-96576512 CCAGAGATCCCATCGTGAAGAGG No data
Right 934720973 2:96576533-96576555 GCCTACTAGATAATTACCTAGGG No data
934720968_934720973 11 Left 934720968 2:96576499-96576521 CCATCGTGAAGAGGTCAGTCTGA No data
Right 934720973 2:96576533-96576555 GCCTACTAGATAATTACCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934720973 Original CRISPR GCCTACTAGATAATTACCTA GGG Intergenic
No off target data available for this crispr