ID: 934723175

View in Genome Browser
Species Human (GRCh38)
Location 2:96596250-96596272
Sequence CTCTGAGAATGTAGTAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 207}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934723172_934723175 -1 Left 934723172 2:96596228-96596250 CCTTGGGAAACTCCTAAGAGGTC 0: 1
1: 0
2: 0
3: 16
4: 105
Right 934723175 2:96596250-96596272 CTCTGAGAATGTAGTAAAGGAGG 0: 1
1: 0
2: 2
3: 14
4: 207
934723169_934723175 1 Left 934723169 2:96596226-96596248 CCCCTTGGGAAACTCCTAAGAGG 0: 1
1: 0
2: 1
3: 15
4: 104
Right 934723175 2:96596250-96596272 CTCTGAGAATGTAGTAAAGGAGG 0: 1
1: 0
2: 2
3: 14
4: 207
934723163_934723175 20 Left 934723163 2:96596207-96596229 CCCCACTTTTCTAAATTTCCCCC 0: 1
1: 0
2: 1
3: 26
4: 334
Right 934723175 2:96596250-96596272 CTCTGAGAATGTAGTAAAGGAGG 0: 1
1: 0
2: 2
3: 14
4: 207
934723168_934723175 2 Left 934723168 2:96596225-96596247 CCCCCTTGGGAAACTCCTAAGAG 0: 1
1: 0
2: 1
3: 10
4: 119
Right 934723175 2:96596250-96596272 CTCTGAGAATGTAGTAAAGGAGG 0: 1
1: 0
2: 2
3: 14
4: 207
934723165_934723175 18 Left 934723165 2:96596209-96596231 CCACTTTTCTAAATTTCCCCCTT 0: 1
1: 1
2: 1
3: 53
4: 492
Right 934723175 2:96596250-96596272 CTCTGAGAATGTAGTAAAGGAGG 0: 1
1: 0
2: 2
3: 14
4: 207
934723171_934723175 0 Left 934723171 2:96596227-96596249 CCCTTGGGAAACTCCTAAGAGGT 0: 1
1: 0
2: 2
3: 6
4: 156
Right 934723175 2:96596250-96596272 CTCTGAGAATGTAGTAAAGGAGG 0: 1
1: 0
2: 2
3: 14
4: 207
934723162_934723175 30 Left 934723162 2:96596197-96596219 CCAACGCTTTCCCCACTTTTCTA 0: 1
1: 0
2: 0
3: 22
4: 289
Right 934723175 2:96596250-96596272 CTCTGAGAATGTAGTAAAGGAGG 0: 1
1: 0
2: 2
3: 14
4: 207
934723164_934723175 19 Left 934723164 2:96596208-96596230 CCCACTTTTCTAAATTTCCCCCT 0: 1
1: 0
2: 4
3: 29
4: 380
Right 934723175 2:96596250-96596272 CTCTGAGAATGTAGTAAAGGAGG 0: 1
1: 0
2: 2
3: 14
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934723175 Original CRISPR CTCTGAGAATGTAGTAAAGG AGG Intronic
902441615 1:16433705-16433727 CTCTGAGAATCTAGACAAGGAGG + Intronic
904594917 1:31637776-31637798 CCCTCAGAATGTAGCAAGGGAGG - Intronic
904645931 1:31966305-31966327 CTCTGAGAATGGAGGAAAGAGGG + Intergenic
904823002 1:33257194-33257216 GTCTGAGAATGTGGGAGAGGCGG + Intronic
909487093 1:76186432-76186454 CTATGAGAATGGAATGAAGGAGG - Intronic
910045941 1:82916555-82916577 CTCTGCTGAAGTAGTAAAGGGGG - Intergenic
913063972 1:115232680-115232702 CTCTGAGAATGCAGACATGGTGG + Intergenic
917044627 1:170845473-170845495 ATATGAGAATGTATTAAAGATGG - Intergenic
917235686 1:172889156-172889178 GTCTGACCATGTAGTAAAGAAGG - Intergenic
917908785 1:179617961-179617983 ATTTGAGAAAGTAGAAAAGGTGG - Intronic
918814054 1:189159833-189159855 CACTGAAAATGTACTATAGGTGG + Intergenic
919584251 1:199416407-199416429 CCCTGAGATTGTAGTATAGTAGG + Intergenic
920224944 1:204431639-204431661 CTCTGTGCAGATAGTAAAGGGGG + Intronic
922080724 1:222293338-222293360 TTCTAATAATGAAGTAAAGGAGG - Intergenic
922804903 1:228380402-228380424 CTCTCAGGAGGTCGTAAAGGAGG - Intergenic
923280709 1:232440471-232440493 ATATGAGAATATTGTAAAGGTGG + Intronic
924425219 1:243944285-243944307 CACGGAGAATGGAGTATAGGCGG - Intergenic
924584859 1:245353386-245353408 CTCTGAGAAGCCAGTAAAGATGG + Intronic
1065279645 10:24121852-24121874 CATTGAGTATGTAATAAAGGTGG - Intronic
1067122116 10:43482324-43482346 CTCTATGAATGTAGTGAATGTGG + Exonic
1069795460 10:71049108-71049130 CTCTGAGAATTCAGCAGAGGTGG + Intergenic
1072191390 10:93079452-93079474 CTCTGCGAATGTAGTGCAGTCGG + Intergenic
1072270661 10:93773451-93773473 TTCTGTGAAAGTAGTAAAGCAGG - Intronic
1073130174 10:101183323-101183345 TACTGAGAATGTAGTCCAGGAGG - Intergenic
1073805390 10:107092107-107092129 CTATGAAAATGTGGTAAAGCAGG + Intronic
1077389064 11:2291043-2291065 CTCTGCGAATATACTAAAGCGGG - Intergenic
1077389086 11:2291150-2291172 CTCTGCGAATATACTAAAGCGGG - Intergenic
1077389097 11:2291206-2291228 CTCTGCGAATATACTAAAGCGGG - Intergenic
1077389150 11:2291477-2291499 CTCTGTGAATATACTAAAGCGGG - Intergenic
1077389247 11:2291960-2291982 CTCTGTGAATATACTAAAGCGGG - Intergenic
1077389291 11:2292174-2292196 CTCTGTGAATATACTAAAGCGGG - Intergenic
1077389324 11:2292338-2292360 CTCTGCGAATATACTAAAGCGGG - Intergenic
1077389367 11:2292560-2292582 CTCTGTGAATATACTAAAGCGGG - Intergenic
1078865919 11:15297127-15297149 CCCTGGGAATGTTGTAAAGAGGG + Intergenic
1080625136 11:34022373-34022395 CTCTGAGACTGTAGAGAAAGAGG + Intergenic
1081522281 11:43894008-43894030 CTCTCAGAATTTTTTAAAGGTGG + Intronic
1085691590 11:78668703-78668725 CTATGAAAATGTAATAATGGTGG + Intronic
1086518605 11:87644984-87645006 CTTCCAGAATGTAGAAAAGGAGG - Intergenic
1086595810 11:88569300-88569322 CACTGAGTAAGTAGGAAAGGAGG + Intronic
1088254059 11:107886529-107886551 CTATGAGAATGTAATCAAGTAGG + Intronic
1088377115 11:109153200-109153222 AGCTGAGAATGGAGAAAAGGTGG + Intergenic
1088721657 11:112597390-112597412 TTCTGTGAATTTAGTAAAGGGGG + Intergenic
1090986044 11:131767151-131767173 CTTTGAGAATTTAGTAAATCGGG - Intronic
1092847420 12:12596642-12596664 CCCTGAGAAGGAAGGAAAGGGGG + Intergenic
1093107901 12:15111630-15111652 CTTTCAGAATGTAGAATAGGGGG + Intronic
1099142085 12:78990744-78990766 TTCTGAAAATGTAATAAAGAAGG + Intronic
1100670733 12:96809858-96809880 TTCTCAGAATGTAGTAAATTAGG - Intronic
1105224670 13:18419822-18419844 CTCTAAGAATGTAATAAATTTGG + Intronic
1107512474 13:41098552-41098574 CTTTGAGAATGTAGTATTTGAGG + Intergenic
1108242837 13:48484891-48484913 CTCTGTTGATGTAATAAAGGGGG + Intergenic
1109194562 13:59363826-59363848 CTCAGAGAAGGAAGTAAAGTGGG + Intergenic
1109793088 13:67275382-67275404 CACTGAGAAGGTAGTATGGGCGG + Intergenic
1110872698 13:80470877-80470899 GTCTGTAAAAGTAGTAAAGGAGG + Intergenic
1110950670 13:81486106-81486128 CTCTGATAATGTATTAAATAAGG - Intergenic
1112135256 13:96571040-96571062 CTGTGAGAATGTAGTTCAGGAGG + Intronic
1112664043 13:101548123-101548145 CTGTTAGAATGTAGAAAAGAAGG + Intronic
1113514554 13:110883205-110883227 CACTGAGAAACTAGTAAATGTGG - Intronic
1118742548 14:68750458-68750480 CTCTGGGAGTGTATTCAAGGGGG - Intergenic
1128167066 15:65475150-65475172 CTCTGACACTGGGGTAAAGGAGG + Intronic
1128470479 15:67947663-67947685 CTCTGAGAGTGTAGTAGTGAAGG - Intergenic
1132509503 16:331326-331348 CCCTGAGAATGTCATAAAGAGGG - Intronic
1133313176 16:4864453-4864475 ATGTGAGAATGTAGTGAACGTGG - Intronic
1133859435 16:9580310-9580332 CACTGAGAATTTAATAAAGGAGG - Intergenic
1136686361 16:31997018-31997040 CCCTGAGCATGCAGTGAAGGAGG - Intergenic
1136786973 16:32940547-32940569 CCCTGAGCATGCAGTGAAGGAGG - Intergenic
1136882799 16:33913242-33913264 CCCTGAGCATGCAGTGAAGGAGG + Intergenic
1137858975 16:51827066-51827088 ATCTAAGAATATAGTACAGGTGG - Intergenic
1140155037 16:72415672-72415694 CTCTGAACATGTAATTAAGGTGG + Intergenic
1142230566 16:88898301-88898323 CTCTGAGAAGCAAGAAAAGGCGG - Intronic
1203089210 16_KI270728v1_random:1202217-1202239 CCCTGAGCATGCAGTGAAGGAGG - Intergenic
1142476860 17:193903-193925 CTCTGCGAATGTGGAAACGGAGG + Intergenic
1143973561 17:10813461-10813483 CTATGAGAATGTGATAAAGAGGG + Intergenic
1146533583 17:33631024-33631046 CTCTCAGATTGGAGTAAAGTTGG + Intronic
1146579284 17:34022400-34022422 CTCTGAGCAGGTTGTATAGGTGG - Intronic
1147147321 17:38492687-38492709 CCCTGAGCATGCAGTGAAGGAGG - Intronic
1147448040 17:40487037-40487059 CTCTGGGCATGTGGTAAAGGGGG + Exonic
1153683933 18:7526709-7526731 ATCTGGGAATGTTATAAAGGAGG + Intergenic
1154528686 18:15319628-15319650 CTCTAAGAATGTAATAAATTTGG - Intergenic
1155124905 18:22863910-22863932 CTTTGACAAAGGAGTAAAGGTGG - Intronic
1156112759 18:33747185-33747207 CTCTGAGAAAGTACAACAGGAGG - Exonic
1156956330 18:42969082-42969104 CTATCAAAATGTAGTAAAAGTGG + Intronic
1158538354 18:58328974-58328996 CCCTGAGCATGCAGGAAAGGGGG - Exonic
1159845829 18:73458776-73458798 CTCTGAGCAGGTAGTGATGGGGG + Intergenic
1160144485 18:76352278-76352300 CTCTGAGAAGGCAGGAAAAGCGG + Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164141177 19:22465869-22465891 CTCTGGGTTTGTAGTAAAGAGGG + Intronic
1164604623 19:29588889-29588911 CTCTGAAACTGTTGTAAAGCTGG - Intergenic
1167758368 19:51427234-51427256 CTGTGAGAATGGAGGAAGGGAGG + Intergenic
1168448187 19:56441229-56441251 CCCTATGAATGTAGTAAATGTGG - Exonic
925724281 2:6858075-6858097 TTCTGAGAACATAGTAAATGTGG - Intronic
926624840 2:15082591-15082613 CTCAGGGAATCTGGTAAAGGAGG - Intergenic
926976272 2:18519900-18519922 CCCTCAAAATGTCGTAAAGGAGG + Intergenic
927703656 2:25283836-25283858 CTCTGAGGAGGTAGTAAGTGAGG - Intronic
928336634 2:30404174-30404196 CTCTGAGAATGGGGTCAGGGAGG + Intergenic
929106818 2:38373602-38373624 CTCAGAGTAGGTAGTGAAGGTGG + Intronic
930931259 2:56886274-56886296 CTCTAAGAAGGTAGTACAGAGGG + Intergenic
932215000 2:69960953-69960975 CTTTGAGAATGTGGTAAAGGTGG - Exonic
934723175 2:96596250-96596272 CTCTGAGAATGTAGTAAAGGAGG + Intronic
935577169 2:104723096-104723118 CTCTGGAAATGTAGTGAAAGGGG - Intergenic
935748182 2:106207917-106207939 CTCTGTAAATATAGTAAATGTGG + Intergenic
938977907 2:136496714-136496736 TTCTGAAAGTGAAGTAAAGGAGG - Intergenic
939691459 2:145267156-145267178 TCCTGAGAATTCAGTAAAGGAGG + Intergenic
940476100 2:154164917-154164939 ATATTAGAATGTATTAAAGGGGG - Intronic
941095036 2:161229409-161229431 CTCTGAGAATGAAGGGATGGAGG + Intronic
941720061 2:168803048-168803070 CTCTGAGAATAAAGTGAGGGAGG + Intronic
943085642 2:183307610-183307632 CTCTGAGAATGGAATATAGTGGG + Intergenic
943146009 2:184045535-184045557 CTCAGAAACTGTAGGAAAGGAGG - Intergenic
946469808 2:219947998-219948020 CTATGAGAAAATAGAAAAGGAGG + Intergenic
949019505 2:241733470-241733492 CTCTGGGGATGTGGTTAAGGAGG + Intergenic
1171350060 20:24495178-24495200 CCCTGAGAATGTCATAAAAGTGG - Intronic
1171394199 20:24820604-24820626 CTCTGAAGATGTTGGAAAGGAGG - Intergenic
1171934107 20:31257347-31257369 CTGTGAGAATGTAGGGGAGGGGG + Intergenic
1173381968 20:42553535-42553557 CTGTGAGAATGAAGTAAACATGG - Intronic
1173752690 20:45489373-45489395 CTCTGGGAATGTAGCCAAGCAGG + Intergenic
1174863410 20:54113702-54113724 CTCTTAGAAAGGAGTAAAGAAGG - Intergenic
1176768722 21:13048883-13048905 CTCTAAGAATGTAATAAATTTGG + Intergenic
1177354319 21:19987974-19987996 CTCTCAAAAAGTAATAAAGGGGG + Intergenic
1179340459 21:40503435-40503457 CTCTGATAATGCAGGAAAGCTGG - Intronic
1179603194 21:42495020-42495042 CTGGGAGAAAGTAGTAAAGAGGG + Intronic
1181655528 22:24294716-24294738 CTCTGGGAACCTAGTCAAGGAGG - Intronic
1181709408 22:24672334-24672356 CTCTGGGAACCTAGTCAAGGAGG - Intergenic
949275143 3:2270547-2270569 CTCTGAGAATGAAGGAAAGTAGG - Intronic
949343755 3:3057573-3057595 CTCTGAGAAAGAAGAAAAGGTGG - Exonic
949758417 3:7440175-7440197 TTCTGAGAATGTTCTAGAGGAGG + Intronic
949926931 3:9048992-9049014 CCCTGAGAATAAAGTGAAGGAGG + Intronic
950314796 3:11991803-11991825 CTCTGGGAATGCAGAGAAGGGGG + Intergenic
952190098 3:31014069-31014091 CTCTGAGACTGCACTAAAGAGGG + Intergenic
952809936 3:37392698-37392720 CTCAGAGATTTTAGGAAAGGAGG - Intronic
953127038 3:40101185-40101207 CTGGGAGAATGGAGGAAAGGGGG - Intronic
953816773 3:46164175-46164197 CACGGAGAATGTAGAAAAGCAGG - Intronic
953840625 3:46387459-46387481 TTCTGAGAATGTGGGAAAAGTGG - Intergenic
954705054 3:52475529-52475551 CTCTGAGAAGCTAGAAAAGACGG + Intronic
963770644 3:149382833-149382855 CTCTGAGACTTCAGTGAAGGTGG - Intergenic
964950749 3:162289662-162289684 CTCTGGGAATGTAAACAAGGAGG - Intergenic
966909977 3:184553834-184553856 CTCAGTGAATGAAGGAAAGGAGG + Intronic
970052707 4:11933317-11933339 CTCTTAGAATGTAGTAAAGAAGG + Intergenic
970667788 4:18358007-18358029 CTCTGGGATTGTAGTCAAGTGGG + Intergenic
971103013 4:23489317-23489339 CCTTGAGAATGGAGTATAGGTGG - Intergenic
972182265 4:36482800-36482822 GTCATAGAATGTAGTAAAAGTGG - Intergenic
972267134 4:37472238-37472260 CTCTGAGAATGAAGAGAATGAGG - Intronic
972338770 4:38132214-38132236 ATCTGAGAATGCAGTCAAGCTGG - Intronic
972730983 4:41794894-41794916 TTCTAAGAATGTAGTAAGAGAGG + Intergenic
974701227 4:65449884-65449906 CTCTCTGAAAGTACTAAAGGAGG - Intronic
975358989 4:73444576-73444598 TTCTGAGAATCCAGGAAAGGAGG - Intronic
976327978 4:83794599-83794621 ATCTGAGACTGTCCTAAAGGAGG - Intergenic
976414264 4:84753684-84753706 CTCAGAGATGGTAGGAAAGGGGG - Exonic
979076775 4:116280910-116280932 GTGTGGGAATGTAGTAAAGTAGG + Intergenic
979752337 4:124294702-124294724 CTCTGAGCCTGTGGTGAAGGAGG - Intergenic
980599606 4:135004206-135004228 CTATGATAATGTATTAAAGAGGG + Intergenic
982139921 4:152307546-152307568 CTCTGAGAATTTAGAAACTGAGG + Intergenic
984705293 4:182843346-182843368 CACTGAGAAATGAGTAAAGGAGG + Intergenic
986095828 5:4553410-4553432 CACTGAGAAGGGAGCAAAGGTGG - Intergenic
987256128 5:16153516-16153538 GTTTTAGAATGTAGAAAAGGTGG + Intronic
994188316 5:96839667-96839689 CTCTGAGCAGGGAGTGAAGGAGG - Intronic
996158878 5:120137730-120137752 CTCTGAGTATATGGTAAAGCTGG - Intergenic
998552807 5:143093794-143093816 CTCTGAGAAGAAAGGAAAGGGGG + Intronic
1005126603 6:22453271-22453293 CTCTGAGAATTGAATAATGGAGG - Intergenic
1005300532 6:24465941-24465963 CCCTGAGAGTGTAGTCAGGGTGG + Intronic
1006765879 6:36506292-36506314 CTATGAAAATGGAGAAAAGGTGG + Intronic
1008041098 6:46799025-46799047 CTGTGAGAGTTTAGTGAAGGAGG + Intronic
1008181049 6:48329580-48329602 CTCTGAGAATATTTTAAATGTGG + Intergenic
1009036106 6:58118653-58118675 CTCAGAGAATGTAGAGAAGCAGG + Intergenic
1009211923 6:60872272-60872294 CTCAGAGAATGTAGAGAAGCAGG + Intergenic
1009953172 6:70419835-70419857 ACCAGAGAATGTAGTAAACGTGG - Intronic
1012330572 6:97980014-97980036 ATGAGTGAATGTAGTAAAGGAGG + Intergenic
1012403432 6:98865309-98865331 GTCTGAGAATGAAGGAAAAGGGG - Intergenic
1015034095 6:128631428-128631450 GTCAGTGAATGTATTAAAGGGGG - Intergenic
1015649815 6:135444111-135444133 GACTGACAAGGTAGTAAAGGAGG - Intronic
1018353599 6:162989096-162989118 CAGTGAGAATGTAGAGAAGGGGG + Intronic
1020048720 7:5065320-5065342 CCCTATGAATGTAGTAAATGTGG + Exonic
1021159374 7:17252906-17252928 GTCTGAGAATGGAATTAAGGTGG + Intergenic
1021162666 7:17295985-17296007 CTGTGAGAATGTATAATAGGTGG - Intergenic
1021548231 7:21840610-21840632 CTATGAGGATCTAGTAAAGGGGG - Intronic
1023462646 7:40416341-40416363 CTCTGAGATTCTAGTAAATAAGG - Intronic
1023497741 7:40815972-40815994 CTCTGAGATTGTGGTATAGCAGG - Intronic
1024427628 7:49245718-49245740 CTCTGACAAAGTTGTAAAAGTGG + Intergenic
1024462957 7:49678987-49679009 CTCTGAGAATGGTGTCAAGATGG + Intergenic
1025960248 7:66214310-66214332 CTCTAAAAATGAAATAAAGGAGG - Intronic
1026539362 7:71266880-71266902 TGGTGAGAATTTAGTAAAGGAGG + Intronic
1026546994 7:71331727-71331749 GTCTGAGAATGTAGGAACGTAGG - Intronic
1027112346 7:75450287-75450309 CTCTGAGAAAGCAGGAAAGCTGG + Intronic
1027112351 7:75450319-75450341 CTCTGAGAAAGCAGGAAAGCTGG + Intronic
1027112356 7:75450351-75450373 CTCTGAGAAAGCAGGAAAGCTGG + Intronic
1027284580 7:76634829-76634851 CTCTGAGAAAGCAGGAAAGCTGG + Intergenic
1027284585 7:76634861-76634883 CTCTGAGAAAGCAGGAAAGCTGG + Intergenic
1027284590 7:76634893-76634915 CTCTGAGAAAGCAGGAAAGCTGG + Intergenic
1027284595 7:76634925-76634947 CTCTGAGAAAGCAGGAAAGCTGG + Intergenic
1027284600 7:76634957-76634979 CTCTGAGAAAGCAGGAAAGCTGG + Intergenic
1031235522 7:119170596-119170618 CTCTGAGAATGTACTAAAAAAGG + Intergenic
1031426938 7:121616627-121616649 CTCAGAGATTGCAGTAAAGATGG - Intergenic
1031452147 7:121935468-121935490 CACAGAGATTGAAGTAAAGGAGG - Intronic
1031563685 7:123268049-123268071 ATCTGTAAATTTAGTAAAGGAGG + Intergenic
1032321603 7:130890853-130890875 CTCTTGGGATGGAGTAAAGGGGG - Intergenic
1034910537 7:154994403-154994425 CTTCCAGAATGTAGTAATGGGGG - Intronic
1036004125 8:4642617-4642639 TTCTCAGAAAGTAGTAGAGGTGG + Intronic
1037253640 8:16926224-16926246 CTGTTAGAATGTTGTGAAGGAGG + Intergenic
1038690732 8:29760735-29760757 CTCTGTGACTGAAGTAAAGTAGG + Intergenic
1041620619 8:59963859-59963881 CCCTGAGACTGTGGTAAAGAGGG + Intergenic
1041716706 8:60939083-60939105 CTCTGAAAAGGCAGGAAAGGTGG - Intergenic
1044447684 8:92297467-92297489 CACTGAGAATGAAGAAAAGCAGG - Intergenic
1045615768 8:103908423-103908445 ATCTGAGAATGTATTAAATATGG - Intronic
1045666829 8:104496971-104496993 CTCTGAGAATGTTTGAAAGAAGG - Exonic
1046675592 8:117104555-117104577 CTCTCAGAAAGAAGTAAAGAAGG - Intronic
1052512926 9:29444847-29444869 CTCTCACAATGTCGTAAAAGAGG + Intergenic
1053238790 9:36479247-36479269 CTCTGAGGATGTTCTAAAGGCGG - Intronic
1053307658 9:36995548-36995570 CTGTGAGAATGGAGGAAAGGAGG + Intronic
1053584773 9:39445435-39445457 CTCTATGAATGTAGTGAATGTGG - Intergenic
1054581544 9:66919787-66919809 CTCTATGAATGTAGTGAATGTGG + Exonic
1055242547 9:74201587-74201609 GTGTAAGAATGCAGTAAAGGGGG - Intergenic
1056302970 9:85260816-85260838 CCCTGACAATGTTGTTAAGGAGG + Intergenic
1057692124 9:97294712-97294734 TTCTGAGAATCTAGAAAATGAGG - Intergenic
1058590231 9:106557729-106557751 CTCTGAGAATGGAGGCAGGGAGG - Intergenic
1061045218 9:128161190-128161212 CACTGAGGATTTAGTAAATGTGG + Intronic
1186035898 X:5423436-5423458 CTGTGAGAATATAGTAGGGGTGG + Intergenic
1187901342 X:24029253-24029275 CTGTTAGAATGTGGTAAATGTGG + Intergenic
1188990333 X:36811296-36811318 CTATGAAAATGTATTAAGGGAGG + Intergenic
1189644670 X:43115058-43115080 CTCTCAGAATGTAGGAAAAGAGG + Intergenic
1190092063 X:47447596-47447618 CACTATGAATGTAGTAAATGTGG - Exonic
1193782969 X:85725708-85725730 CTCTGAAAATGTAGTAGAATTGG + Intergenic
1194240645 X:91443052-91443074 CAATGAGAATGTAGAAAAGGTGG + Intergenic
1194270066 X:91801752-91801774 CTCTCAGAATGTATTAAAAATGG + Intronic
1196613648 X:117742862-117742884 CCCTGAGATTGTAGTACAGTGGG + Intergenic
1198823130 X:140670218-140670240 CTATCACAAAGTAGTAAAGGAGG - Intergenic
1201464564 Y:14266291-14266313 CTCTGAGAATGAAGTCATGTAGG + Intergenic