ID: 934725664

View in Genome Browser
Species Human (GRCh38)
Location 2:96616770-96616792
Sequence ATGCTGCTGGGCCACGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934725664_934725672 9 Left 934725664 2:96616770-96616792 CCCACACCGTGGCCCAGCAGCAT 0: 1
1: 0
2: 0
3: 13
4: 142
Right 934725672 2:96616802-96616824 ACACCCAACTATGCATGCTATGG 0: 1
1: 0
2: 0
3: 9
4: 59
934725664_934725675 23 Left 934725664 2:96616770-96616792 CCCACACCGTGGCCCAGCAGCAT 0: 1
1: 0
2: 0
3: 13
4: 142
Right 934725675 2:96616816-96616838 ATGCTATGGAGTCCCCCCAGTGG 0: 1
1: 0
2: 0
3: 2
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934725664 Original CRISPR ATGCTGCTGGGCCACGGTGT GGG (reversed) Intronic
900380997 1:2383862-2383884 AGGCTGCTGGTCCACAGTGTGGG - Intronic
901196284 1:7441814-7441836 ATGCTGCAGGGCCTCGGGATGGG - Intronic
904033521 1:27547516-27547538 CTGCAGCAGGGCCACGGGGTGGG + Exonic
904539928 1:31225893-31225915 ATGCTGGTGGGACACTGGGTGGG + Intronic
904848457 1:33438776-33438798 ATGGTGCTGGGCCCCGGGTTAGG - Intergenic
906127741 1:43437872-43437894 CAGCTGCTGGTCCATGGTGTTGG + Exonic
906237316 1:44219857-44219879 ATGCTGCTGGAGCTTGGTGTGGG + Exonic
907115012 1:51960524-51960546 ATGGTGTTGGGCAACGGTGTGGG + Intronic
910753229 1:90657223-90657245 ATGCTGCTGGCCCACAGGCTTGG - Intergenic
913340463 1:117753149-117753171 ATCCTGCTGGGCCCTGGTCTTGG - Intergenic
915264656 1:154708117-154708139 CTGCTGCTGGCGCAGGGTGTCGG + Exonic
916842193 1:168612320-168612342 AAGCTGCTGGGCCACAGTTCAGG + Intergenic
917041321 1:170809275-170809297 ATGGTGCTGGGCCAGGGGGCAGG + Intergenic
922485825 1:225972455-225972477 ATGCTGCTGTGCCCCGGGGTGGG + Intergenic
923068904 1:230545029-230545051 TTGCTGCTGGGCCCATGTGTAGG - Intergenic
1070664688 10:78334656-78334678 ATGCTGGTGGGCCAGCATGTGGG - Intergenic
1071206868 10:83290180-83290202 AGGCTGCTGGACCACTGTGATGG + Intergenic
1071500996 10:86204315-86204337 AGGCTGCAGGGCCATGGTGGTGG + Intronic
1072041540 10:91611389-91611411 ATCCTGCTGAGCCAAGCTGTGGG + Intergenic
1076466317 10:130684457-130684479 ATTCTGCTGGTCCACGGTAGTGG + Intergenic
1077066049 11:641313-641335 ATGTGGCTGGGCCAAGGGGTGGG + Intergenic
1077481895 11:2818858-2818880 ATTCTGCTGGGCCTGGGGGTTGG - Intronic
1078169464 11:8918106-8918128 ATGCTGATGTTCCACCGTGTTGG + Intronic
1079444238 11:20545373-20545395 AGGCAGCTGGGCCTCTGTGTGGG + Intergenic
1081623464 11:44632866-44632888 ATGCCCCTGGCCCACGGTGTGGG + Intergenic
1081873313 11:46392735-46392757 AGGCTGCTGGGCCAGGGCGCGGG - Intergenic
1086927874 11:92660258-92660280 GTGCTGCTGGGACAAGGTGGGGG + Intronic
1088912059 11:114199301-114199323 ATGCCGCTGGGCCCCGGGATGGG + Intronic
1103041103 12:117696213-117696235 AGGCTGCTGGGCCCCGGCTTGGG + Intronic
1103126336 12:118425887-118425909 ATGATGATGGGCCTTGGTGTGGG + Intergenic
1103999126 12:124849229-124849251 ATGCTGCTGGGACACACTGCAGG + Intronic
1104606400 12:130192765-130192787 ATGCAGCTGGGCCTGGGTGGGGG + Intergenic
1104916487 12:132267463-132267485 GGGGTGCTGGGCGACGGTGTGGG - Intronic
1105263064 13:18794057-18794079 CAGCAGCTGGGCCACGGTGCTGG + Intergenic
1106393613 13:29359439-29359461 ATGCTGCGTGGCCACGGCGAGGG - Exonic
1108457438 13:50630430-50630452 TTGCTGCTGGTCCTCTGTGTGGG - Intronic
1112551458 13:100424573-100424595 CTGCTTCTGGGACACAGTGTAGG - Intronic
1113635968 13:111919344-111919366 ACCCTGCTGGGCCACTGTGGGGG - Intergenic
1119990179 14:79187953-79187975 AAGCTGCTGGGTTACAGTGTTGG - Intronic
1121953330 14:98191750-98191772 ATGTTTATGGGCCAGGGTGTGGG - Intergenic
1122206961 14:100152462-100152484 ATGGTGCTGGCCCACATTGTGGG - Intronic
1122920038 14:104876257-104876279 ATGCTGCTTGTCCACGCTGCGGG - Exonic
1122979640 14:105185727-105185749 ATGCTCCTGGGCCATGCTGGAGG + Intergenic
1123123246 14:105927757-105927779 ATCCTGCAGGGCCAAGGTCTGGG + Intronic
1128575546 15:68772100-68772122 AAGCTGCTGAGCCATGGTGATGG + Intergenic
1131512276 15:93055996-93056018 ATGCTCCAGGGCCACAGAGTGGG + Intronic
1134509325 16:14833852-14833874 ATGCTGGTGGGCCAGGGCGCGGG + Exonic
1134697030 16:16232667-16232689 ATGCTGGTGGGCCAGGGCGCGGG + Exonic
1134974812 16:18562018-18562040 ATGCTGGTGGGCCAGGGCGCGGG - Exonic
1139483080 16:67241380-67241402 AGGCTGCTGAGTCACTGTGTGGG - Intronic
1142595721 17:1028927-1028949 ATGCTGCGGGGGCAGGGTGGGGG + Intronic
1142676792 17:1518446-1518468 TTGCTGCTGGGCAACAGTGTTGG - Exonic
1145127371 17:20313518-20313540 GTGCTGCTGTGCCACTGTGCGGG - Intronic
1147400823 17:40178986-40179008 ATGCTGCAGGGCCATGATGCCGG - Intronic
1148367517 17:47067449-47067471 CTGCCGTTGGGCCCCGGTGTTGG + Intergenic
1148619102 17:49021437-49021459 ACGCTGCTGGGCCAAGGAGGAGG - Intronic
1152205027 17:78970049-78970071 CTGCCGCTGTGCCACGGTCTGGG - Intergenic
1153812772 18:8766379-8766401 CTGCTGCAGGGACACTGTGTAGG + Intronic
1154494838 18:14948003-14948025 ATGCTGCTGTACCACGGTTAGGG + Intergenic
1155231440 18:23778782-23778804 CTCCTGCAGCGCCACGGTGTGGG + Intronic
1157866716 18:51194194-51194216 ATGCTGCTGGGACATGGGGGTGG + Intronic
1158162565 18:54502099-54502121 ATTCTGCTAGGCCAGGGTCTTGG + Intergenic
1159927398 18:74281530-74281552 AGTCTGCTGAGCCACTGTGTTGG + Intronic
1160455117 18:78994237-78994259 CTGCTGCAGGACCACGGCGTTGG - Exonic
1160548693 18:79679615-79679637 ATGCCGCTGCTCCACGGTGCCGG + Intergenic
1160821899 19:1062820-1062842 ATGGAGCAGGGCCATGGTGTGGG - Intronic
1160821923 19:1062898-1062920 ATGGGGCGGGGCCATGGTGTGGG - Intronic
1160821935 19:1062937-1062959 ATGGGGCGGGGCCATGGTGTGGG - Intronic
1160821947 19:1062976-1062998 ATGGGGCGGGGCCATGGTGTGGG - Intronic
1160821970 19:1063054-1063076 ATGGGGCAGGGCCATGGTGTGGG - Intronic
1160821980 19:1063093-1063115 ATGCGGCGGGGCCATGGTGTGGG - Intronic
1160822000 19:1063168-1063190 ATGGGGCGGGGCCATGGTGTGGG - Intronic
1160822021 19:1063243-1063265 ATGGGGCGGGGCCATGGTGTGGG - Intronic
1160822046 19:1063321-1063343 ATGGGGCGGGGCCATGGTGTGGG - Intronic
1160822058 19:1063360-1063382 ATGGGGCGGGGCCATGGTGTGGG - Intronic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1162329218 19:10017129-10017151 GTCCAGCTGGGCCACGGTGAGGG - Exonic
1163127265 19:15251085-15251107 ATGCTGCTGGGGCAGAGGGTGGG + Intronic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1166328360 19:42065048-42065070 CTGCTGCTGGGCCTGGGGGTTGG - Intronic
927506860 2:23620476-23620498 AGGCTGCTGGGGCATGGCGTGGG + Intronic
934725664 2:96616770-96616792 ATGCTGCTGGGCCACGGTGTGGG - Intronic
938164220 2:129011913-129011935 ATGCAGCTGGGCCAGGCAGTTGG + Intergenic
944712910 2:202351645-202351667 ATGCTGCTGTGCTCCAGTGTGGG - Intergenic
947049906 2:226030820-226030842 GTGCTCCTGGGCCACGCTGGCGG - Intergenic
948171522 2:235907095-235907117 AAGCTGCTGGGACACAGGGTAGG - Intronic
948191709 2:236064209-236064231 ATGCTCCTAAGCCACGCTGTTGG - Intronic
948557290 2:238822127-238822149 ATGCTTCTGGACCTGGGTGTGGG - Intergenic
948818132 2:240523927-240523949 AAGCTGCTGGTGCACGGTGAGGG + Exonic
1168769105 20:402931-402953 ATGCTGCTGGGCCTCCAAGTTGG + Intergenic
1169061473 20:2663697-2663719 ATGCTTCCGGGAGACGGTGTGGG - Exonic
1174292657 20:49519888-49519910 GTGCTGCTGGGCCAGGGTCAGGG - Intronic
1176128839 20:63487803-63487825 TTGCTGCTGGGCCACGGCCTGGG + Intergenic
1176163795 20:63662477-63662499 ACGCTGCAGGGCCACGCTGTGGG + Intronic
1180887429 22:19256785-19256807 AAGATGCTGGGCCAGGGTGGTGG - Intronic
1183061365 22:35338199-35338221 ATGCTGCTGAGACAAGGTGGGGG + Intronic
1183291411 22:37003965-37003987 ATGGAGCTGGGCCACGGAGCAGG - Exonic
1183309365 22:37101152-37101174 CTGGTGCTGGGCCATTGTGTGGG + Intronic
1183508645 22:38222764-38222786 GTGCTGGTGGGCCTCGGTGGTGG - Intronic
1184361988 22:44024361-44024383 ATCCTGCGGGGCCGCGGGGTGGG - Intronic
1184489744 22:44801680-44801702 ATGATTCTGGGCCATGGTGGAGG - Intronic
1184678566 22:46056484-46056506 ACGCTGCCCGGCCACGGTGACGG - Intronic
949459610 3:4276135-4276157 ATGATGCTGGGCCATGGGGGTGG - Intronic
950291844 3:11791082-11791104 ATGCTGTGGGGCCACCCTGTGGG - Intronic
950520207 3:13493606-13493628 ATGGTGCTGGTCTAGGGTGTTGG + Intronic
951809132 3:26680146-26680168 ATGCTGCTGGTCCACAGTCCAGG + Intronic
951994809 3:28715100-28715122 ATGCTGCTGGCCCTAGGTGAGGG + Intergenic
953412621 3:42698808-42698830 CTGCTGCTTGGTCACTGTGTGGG - Exonic
953666179 3:44928041-44928063 ATACTGCCGGGCCACGGTCTGGG - Intronic
971068823 4:23066949-23066971 ATCCTGCTGGGCCATGGTTTTGG + Intergenic
974009295 4:56592685-56592707 CTGCTCCTGGGCCGCGGGGTCGG + Intronic
977262751 4:94817724-94817746 ATGCTTCAGGGTCAGGGTGTGGG + Intronic
992476542 5:77107944-77107966 ATGCTGCTGGGTCAGTGTGTGGG - Intergenic
992742933 5:79791983-79792005 GTGCTGCTGTGCCCTGGTGTCGG + Intronic
992993664 5:82311512-82311534 AGGCTGCTGGGCCAGGGACTGGG - Intronic
994911717 5:105918019-105918041 ATGATGCTGGGCCATGCTGTTGG + Intergenic
1000287318 5:159837894-159837916 AGGATGATGGGCCACAGTGTTGG - Intergenic
1002568743 5:180128425-180128447 CAGCTGCTGGGCCAGTGTGTAGG + Exonic
1003203806 6:3989107-3989129 CTGCTTCTGGGCCATGGTGGTGG + Intergenic
1003645548 6:7910685-7910707 CTGCTGCTGGGCCATGGCGGCGG - Exonic
1004285571 6:14317802-14317824 ATGCATCAGGACCACGGTGTTGG + Intergenic
1006257894 6:32845602-32845624 GTGCTACTGGGCCATGGTGCAGG - Exonic
1007662573 6:43495786-43495808 ATGCTGTAGGGCCAGGGAGTGGG + Intronic
1016558942 6:145372710-145372732 ATGCAGCTTGGCCATGTTGTGGG - Intergenic
1018702421 6:166437431-166437453 ATGCTGACGCGCCACGGAGTAGG + Intronic
1019540992 7:1550941-1550963 TTGCTCCTGTGGCACGGTGTAGG + Exonic
1019588413 7:1816812-1816834 AAGCTGCTGTGCCACGGTCCTGG + Intronic
1020689777 7:11339761-11339783 ATGCTGGTGGGGCAGGGTGAGGG + Intergenic
1023862737 7:44225783-44225805 AGGCTGCTGGGCCACGGGCTCGG - Intronic
1024208239 7:47182024-47182046 AAGCTGCTGGGGCATGGTGGGGG - Intergenic
1024234240 7:47385802-47385824 ATGCTGCTGGGCCCCTGACTAGG - Intronic
1031890969 7:127293190-127293212 TTGCTGCTGGTCCATGGTGGAGG + Intergenic
1031974341 7:128084436-128084458 AGTCTGCTGGCCCAGGGTGTGGG - Intronic
1032346243 7:131119342-131119364 ATGCTGCAGAGCCACAGTGGTGG - Intronic
1032410822 7:131692393-131692415 ATGCGGCAGGGCCACCGTGGGGG + Intergenic
1036077214 8:5515157-5515179 ATCTTGCTGGTCCATGGTGTTGG + Intergenic
1037731026 8:21524184-21524206 ATATTGCTGGGGCAAGGTGTGGG - Intergenic
1037945620 8:22987783-22987805 TTGCTGCTGGGCCACAGTCCAGG - Intronic
1039552642 8:38454167-38454189 AAGCTGCTGGGGCAGGGTGGAGG - Intronic
1044791576 8:95852793-95852815 ATGCTGCTGGGTGAGGGTGAGGG - Intergenic
1045370845 8:101521208-101521230 ATGCAGCAGGGCCATGGGGTGGG + Intronic
1047306073 8:123654090-123654112 ATGGTTCTGGGCCACAGTGGAGG + Intergenic
1049499152 8:142952270-142952292 ACGCTGCTTGGCCATGCTGTTGG - Intergenic
1049676607 8:143892030-143892052 AGGCTTCTGGGTCACGGGGTGGG - Intergenic
1049824674 8:144661137-144661159 AAGCTGCTGGGACCCTGTGTAGG - Intergenic
1050105102 9:2157412-2157434 ATGCTGCTGGGCATGGGGGTGGG - Intronic
1051991956 9:23162640-23162662 CTGCTGCTGGGACAGGGGGTAGG - Intergenic
1053345998 9:37378668-37378690 ATGCTTTTGGGCCACTGCGTGGG + Intergenic
1058053588 9:100428591-100428613 AGGCTGCTGGGGCAGGGGGTGGG + Intronic
1059241404 9:112809419-112809441 ATGCTACTGGACCACAGTGCTGG - Intronic
1060588508 9:124801577-124801599 CTGCTGCTGGGCCAGGGCGCGGG - Exonic
1186256609 X:7728661-7728683 ATGCTGTAAGGACACGGTGTAGG + Intergenic
1186581863 X:10828325-10828347 ATTCTGCTGGGGTAGGGTGTTGG + Intronic
1188712317 X:33415823-33415845 ATGCTGCTTGGCCACTGGGATGG - Intergenic
1189988641 X:46574871-46574893 GTGCTGCTGGCGCACGGCGTGGG + Exonic
1195084193 X:101398800-101398822 ATGTTGCTGGACCAGGGGGTTGG - Exonic